ID: 946594551

View in Genome Browser
Species Human (GRCh38)
Location 2:221291934-221291956
Sequence CTTCCCATACATAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946594551_946594556 7 Left 946594551 2:221291934-221291956 CCATCCTCATTATGTATGGGAAG No data
Right 946594556 2:221291964-221291986 AGGTAAGATTATTTTGGGATTGG No data
946594551_946594555 2 Left 946594551 2:221291934-221291956 CCATCCTCATTATGTATGGGAAG No data
Right 946594555 2:221291959-221291981 ATTCAAGGTAAGATTATTTTGGG No data
946594551_946594557 10 Left 946594551 2:221291934-221291956 CCATCCTCATTATGTATGGGAAG No data
Right 946594557 2:221291967-221291989 TAAGATTATTTTGGGATTGGAGG No data
946594551_946594558 16 Left 946594551 2:221291934-221291956 CCATCCTCATTATGTATGGGAAG No data
Right 946594558 2:221291973-221291995 TATTTTGGGATTGGAGGATGAGG No data
946594551_946594559 21 Left 946594551 2:221291934-221291956 CCATCCTCATTATGTATGGGAAG No data
Right 946594559 2:221291978-221292000 TGGGATTGGAGGATGAGGAGTGG No data
946594551_946594554 1 Left 946594551 2:221291934-221291956 CCATCCTCATTATGTATGGGAAG No data
Right 946594554 2:221291958-221291980 GATTCAAGGTAAGATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946594551 Original CRISPR CTTCCCATACATAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr