ID: 946598715

View in Genome Browser
Species Human (GRCh38)
Location 2:221335476-221335498
Sequence CAGCATAAGGAGACGGTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946598715_946598719 13 Left 946598715 2:221335476-221335498 CCGGCTACCGTCTCCTTATGCTG No data
Right 946598719 2:221335512-221335534 TGTCGAGTCAATTGCTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946598715 Original CRISPR CAGCATAAGGAGACGGTAGC CGG (reversed) Intergenic
No off target data available for this crispr