ID: 946601325

View in Genome Browser
Species Human (GRCh38)
Location 2:221363204-221363226
Sequence GTGGGAAGAAGCTGTATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946601325_946601327 -8 Left 946601325 2:221363204-221363226 CCTCAAATACAGCTTCTTCCCAC No data
Right 946601327 2:221363219-221363241 CTTCCCACCTCCTGGCTTTCTGG No data
946601325_946601332 5 Left 946601325 2:221363204-221363226 CCTCAAATACAGCTTCTTCCCAC No data
Right 946601332 2:221363232-221363254 GGCTTTCTGGTTCTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946601325 Original CRISPR GTGGGAAGAAGCTGTATTTG AGG (reversed) Intergenic
No off target data available for this crispr