ID: 946601332

View in Genome Browser
Species Human (GRCh38)
Location 2:221363232-221363254
Sequence GGCTTTCTGGTTCTTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946601324_946601332 15 Left 946601324 2:221363194-221363216 CCTTTCTCAGCCTCAAATACAGC No data
Right 946601332 2:221363232-221363254 GGCTTTCTGGTTCTTGTGTCTGG No data
946601325_946601332 5 Left 946601325 2:221363204-221363226 CCTCAAATACAGCTTCTTCCCAC No data
Right 946601332 2:221363232-221363254 GGCTTTCTGGTTCTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946601332 Original CRISPR GGCTTTCTGGTTCTTGTGTC TGG Intergenic
No off target data available for this crispr