ID: 946612004

View in Genome Browser
Species Human (GRCh38)
Location 2:221468868-221468890
Sequence CAAGATGACAACAACCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946612004_946612005 15 Left 946612004 2:221468868-221468890 CCACTATGGTTGTTGTCATCTTG 0: 1
1: 0
2: 1
3: 13
4: 118
Right 946612005 2:221468906-221468928 TAACTAATTCAGAAGTGTTGTGG 0: 1
1: 0
2: 1
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946612004 Original CRISPR CAAGATGACAACAACCATAG TGG (reversed) Intronic
905716362 1:40154155-40154177 CAAGAGGACTACAACCTGAGAGG + Intergenic
905769698 1:40629486-40629508 CAAGATGGCACCAACCACATGGG + Intronic
908495452 1:64689746-64689768 CAGGATGACCACAGCCATAGAGG - Intronic
909321798 1:74298124-74298146 CAGAATGAGATCAACCATAGTGG - Intronic
921984131 1:221292122-221292144 CAAGATGACAACAACAAGTAGGG + Intergenic
1066753917 10:38690279-38690301 CAGGATGACAATAATCAGAGGGG - Intergenic
1074179059 10:111041604-111041626 CAAAATTAAAACAAACATAGTGG + Intergenic
1075245465 10:120818389-120818411 CAATATGACAACAAGCCAAGAGG + Intergenic
1077937738 11:6807033-6807055 CAAGAGGCCAACAAACATAATGG - Intergenic
1078636012 11:13051021-13051043 CTAGAAGTCAACAAACATAGGGG - Intergenic
1079026402 11:16951376-16951398 GAAGAAGACAACAACAATAACGG + Intronic
1079718767 11:23784662-23784684 GAAGATGACAAGAGCCACAGAGG - Intergenic
1080721151 11:34849869-34849891 CATGATGACATCAAATATAGTGG - Intergenic
1081063614 11:38511028-38511050 CAAGATGAAAAGATCTATAGAGG - Intergenic
1083495955 11:63053190-63053212 CAAGAAGTCTACAATCATAGTGG - Intergenic
1083688885 11:64394528-64394550 CAACATGTCAATAACCATAGTGG + Intergenic
1087634503 11:100687419-100687441 CCAGATGACAACAACCTGAGGGG + Intergenic
1088015609 11:105055362-105055384 AATGATGACAACAATGATAGTGG - Intronic
1090194705 11:124804781-124804803 CCAGCTGACGACAACCATACCGG + Intergenic
1094323968 12:29216363-29216385 CTAAAGGACAACAACCAAAGGGG - Intronic
1097337304 12:58397134-58397156 GAAGAGAACAACAAACATAGGGG - Intergenic
1097382501 12:58911838-58911860 GTAGATGAAAACAACCAGAGAGG + Intronic
1099007451 12:77250730-77250752 CCAGATAAAAGCAACCATAGTGG - Intergenic
1100685495 12:96982880-96982902 AAAGCTGACAACAACCTTGGGGG + Intergenic
1100734780 12:97514252-97514274 CCAGATGACAACATCCTTATGGG + Intergenic
1107848562 13:44546348-44546370 CAAGATGACATCACCAATAATGG + Intronic
1108530168 13:51320980-51321002 TATGAGGACACCAACCATAGGGG + Intergenic
1110688418 13:78402737-78402759 CAAGAGGAAACCACCCATAGGGG + Intergenic
1112126350 13:96472542-96472564 CAAGATGCCAAGAAGCACAGAGG - Intronic
1112965107 13:105180701-105180723 CAAAATGACAACACCTAAAGAGG - Intergenic
1116610309 14:47061512-47061534 AAAGATGACAACATCCAGATTGG - Exonic
1121537745 14:94702638-94702660 TAAGCTTACAACAACCCTAGAGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125398699 15:39276988-39277010 CAAAATGACAACAACCTTTGGGG + Intergenic
1126292548 15:47099039-47099061 AAAGATGCCACCAACCACAGAGG - Intergenic
1128991299 15:72262659-72262681 CAGGATGAGAACAATTATAGTGG - Intronic
1130175825 15:81569586-81569608 CAAGATGCCAAGAAGCTTAGAGG + Intergenic
1131194051 15:90340900-90340922 CCAGATGTCAACACACATAGAGG + Intergenic
1135628920 16:24020829-24020851 CAAGCTAACAGCATCCATAGAGG - Intronic
1136728826 16:32386906-32386928 CAGGATGACAATAATCAGAGGGG + Intergenic
1140988177 16:80179840-80179862 TAACTTGACATCAACCATAGTGG - Intergenic
1202997609 16_KI270728v1_random:130833-130855 CAGGATGACAATAATCAGAGGGG - Intergenic
1203024296 16_KI270728v1_random:443175-443197 CAGGATGACAATAATCAGAGGGG - Intergenic
1143415043 17:6741032-6741054 GAAGATCACTACAACAATAGAGG - Intergenic
1145741724 17:27280529-27280551 GAAGATGACCACAGCCATGGCGG + Intergenic
1148345009 17:46897394-46897416 CCAGATGTCAACAACCCCAGGGG - Intergenic
1148482200 17:47967403-47967425 CAAGCTAACAACAACAATAATGG + Intergenic
1150852305 17:68715137-68715159 CAAGAGGCCACAAACCATAGAGG + Intergenic
1151092987 17:71463689-71463711 GAAGGTGAGAACAACCATGGGGG + Intergenic
1155674054 18:28408299-28408321 CAAGATGACTACAACACTATTGG - Intergenic
1155794195 18:30013493-30013515 AAAGTTGACAACAACCAAATGGG + Intergenic
1156610078 18:38715211-38715233 CAAGCAGATAACAACCAGAGAGG + Intergenic
1160247742 18:77172882-77172904 CAAGAAGACAACAATCACTGCGG + Intergenic
1166114591 19:40645840-40645862 CAAAATGTCAACAACCATAGTGG - Intergenic
927459221 2:23283342-23283364 CAAGATGACACCAATAATAAGGG + Intergenic
928280471 2:29941964-29941986 CAGGATGACAATGACAATAGTGG - Intergenic
929136955 2:38633946-38633968 AAAGATGACAACAAAGATACTGG - Intergenic
929660592 2:43780414-43780436 AGAGATGACAACAACCCTGGTGG + Intronic
930857210 2:56031652-56031674 TGAGCTGACAACAACCACAGTGG - Intergenic
933637746 2:84725862-84725884 CAACCTGACAAGAACCATAGAGG - Intronic
934185104 2:89664802-89664824 CAGGATGACAATAATCAGAGGGG + Intergenic
934317203 2:91934510-91934532 CAGGATGACAATAATCAGAGGGG - Intergenic
936276291 2:111100644-111100666 CAAAATGAAAACAGCCCTAGAGG - Intronic
936954590 2:118012054-118012076 CCAGCTTACAACAACTATAGTGG - Intronic
938802481 2:134775720-134775742 CAAAATGGCTACAACTATAGGGG - Intergenic
939747409 2:145992939-145992961 CTAAATGAAAACAACCATTGTGG + Intergenic
940191023 2:151040043-151040065 GAAGATGAGAACAATAATAGAGG + Intronic
944052054 2:195480887-195480909 CATGAGGACATCAACCATACTGG - Intergenic
946599804 2:221347217-221347239 CTATATGACATCAACTATAGTGG - Intergenic
946612004 2:221468868-221468890 CAAGATGACAACAACCATAGTGG - Intronic
1172716762 20:36970035-36970057 CAAGAGGACCAGAACCATTGTGG + Intergenic
1176691237 21:9912830-9912852 CACAATGACAACAACCATCTTGG + Intergenic
1178092602 21:29180386-29180408 CAAAATAATAACAACCACAGAGG - Intergenic
1179147043 21:38777018-38777040 ACAAATGACAACAAGCATAGTGG - Intergenic
949277223 3:2298235-2298257 CAAGACGACAAGAACCTTAAAGG - Intronic
951579001 3:24142438-24142460 CAACATAACAACAACCTTAAAGG - Intronic
953507758 3:43502979-43503001 CAAGATGAAAAGAATTATAGAGG + Intronic
954345258 3:49991848-49991870 CAGGATGACAGCAAACATAGTGG - Intronic
965542121 3:169880719-169880741 CAAGATGCCACCAGCCACAGAGG + Intergenic
965890549 3:173508595-173508617 CCAGAGAAGAACAACCATAGAGG - Intronic
966449746 3:180044496-180044518 CAAGATTAAAACAACTATAGAGG + Intergenic
971685856 4:29766261-29766283 CAAGATGAGAATGAACATAGAGG - Intergenic
971836726 4:31775029-31775051 GAAAATGACAACAACAACAGCGG - Intergenic
972062378 4:34892640-34892662 CAAGAAGATAACAATCATGGAGG - Intergenic
972646021 4:40968127-40968149 GAAGATGACACCAACCTTAAAGG - Intronic
974722908 4:65765246-65765268 CAATATGACAAAAACCGTGGAGG - Intergenic
974934840 4:68399599-68399621 CCAGATGAAGAGAACCATAGGGG - Intergenic
977177299 4:93833053-93833075 CAAGAGAAAAACAACCATAACGG + Intergenic
977949198 4:102950640-102950662 CAGGATGACAATAATCAGAGGGG - Intronic
978456715 4:108900823-108900845 TAAAATGACAACAGCCATATTGG + Intronic
980363819 4:131773016-131773038 CACAATGACAACAACCATCTTGG + Intergenic
981001547 4:139833563-139833585 CAAGATCATCACAACCCTAGTGG + Intronic
982091058 4:151880421-151880443 TAATATTAGAACAACCATAGTGG + Intergenic
986344870 5:6825124-6825146 GAAGATGAAAACAACCCAAGAGG - Intergenic
987652454 5:20760280-20760302 CAAGATGACAGCAAGCATTCTGG + Intergenic
988743105 5:34101203-34101225 CAAGATGACAGCAAGCATTCTGG - Intronic
990197116 5:53330326-53330348 CAAGATGGCTACCACCAAAGAGG + Intergenic
990624045 5:57591819-57591841 TGACATGACAACAACCATATTGG + Intergenic
997786369 5:136717678-136717700 CAACATGATAAGAACCATAATGG + Intergenic
1000810590 5:165856842-165856864 CAAGAGGAAATCAACCATTGTGG - Intergenic
1001371496 5:171208645-171208667 CAAGATAACAAGATACATAGAGG + Intronic
1001658278 5:173370903-173370925 CAAGATGACCACAAGCAGAGAGG - Intergenic
1001716350 5:173819369-173819391 CAAAAAGAAGACAACCATAGTGG + Intergenic
1002366139 5:178713165-178713187 AAACATGAGAAAAACCATAGTGG - Exonic
1003566010 6:7222805-7222827 AAAAATCACTACAACCATAGAGG + Intronic
1011513878 6:88130981-88131003 AAAGTTGGCAAGAACCATAGTGG + Intergenic
1013043062 6:106456131-106456153 CAAGCTGTCAAAAACAATAGTGG - Intergenic
1015036674 6:128664233-128664255 CAAGATGAGAGAAACAATAGAGG + Intergenic
1018507409 6:164486192-164486214 CATGATGAAAACAACCAATGGGG - Intergenic
1022413812 7:30160989-30161011 AAAGATGACAGCAACTATAAAGG - Exonic
1022970074 7:35508839-35508861 CCAGAGGGCAACAACCAAAGTGG + Intergenic
1029564299 7:101325285-101325307 AAAGATGACAGCATTCATAGGGG - Intergenic
1030521118 7:110599284-110599306 CAATATGACACAAAACATAGTGG + Intergenic
1037016366 8:13912650-13912672 CAAGATGACAAGCAAGATAGTGG + Intergenic
1039131379 8:34268098-34268120 CAAGATGACAATGACGATGGTGG + Intergenic
1039558848 8:38496706-38496728 CAAGATGACAACACTCTTAGAGG + Intergenic
1041668035 8:60465057-60465079 CAAGAAGACACCAAGCACAGAGG + Intergenic
1045651905 8:104349146-104349168 CCAGATGGCAACAACCACAGAGG + Exonic
1048450830 8:134532620-134532642 TAATATGACAACAACCTTAGTGG - Intronic
1049880195 8:145056791-145056813 AAACATGCCAACAACCATTGTGG + Intergenic
1051958721 9:22731704-22731726 AAAGGTGACATCAACAATAGTGG - Intergenic
1055487213 9:76767863-76767885 GAAGATGAGAATAGCCATAGTGG - Intronic
1055793132 9:79945317-79945339 CAAGATGACAACAGCTATCTTGG - Intergenic
1057914447 9:99044984-99045006 CAAGCTGAGAACAACCACAGTGG - Intronic
1189694332 X:43648381-43648403 AAAGATGACAACAATGATAAAGG + Intergenic
1193694635 X:84693045-84693067 CAAGGCTACAACAACCAAAGTGG - Intergenic
1195416481 X:104625659-104625681 CAAGATGGGAAGAACCAGAGAGG + Intronic
1197940097 X:131779905-131779927 CAATTTGGCAAGAACCATAGAGG + Intergenic
1200302445 X:154991178-154991200 AAAGAGGACAAAAACCCTAGGGG + Intronic
1200439564 Y:3195017-3195039 GGAGATGACAACAAGGATAGTGG + Intergenic
1200888121 Y:8292588-8292610 CAAGAAGAAAACCAACATAGGGG + Intergenic
1201184519 Y:11386899-11386921 CAAGATGACAATAATCAGAGGGG - Intergenic
1201539748 Y:15093173-15093195 CAAGTTGCCAACAATCACAGAGG + Intergenic