ID: 946616182

View in Genome Browser
Species Human (GRCh38)
Location 2:221513131-221513153
Sequence AACACTGAGGTGGGTACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946616175_946616182 19 Left 946616175 2:221513089-221513111 CCAGAAGAAGCTAAAATAATAGT 0: 1
1: 0
2: 4
3: 43
4: 464
Right 946616182 2:221513131-221513153 AACACTGAGGTGGGTACTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 182
946616174_946616182 20 Left 946616174 2:221513088-221513110 CCCAGAAGAAGCTAAAATAATAG 0: 1
1: 0
2: 1
3: 48
4: 389
Right 946616182 2:221513131-221513153 AACACTGAGGTGGGTACTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946616182 Original CRISPR AACACTGAGGTGGGTACTGT GGG Intronic
900568425 1:3346728-3346750 CACAGTGGGGTGGGTGCTGTTGG - Intronic
903327253 1:22576556-22576578 AACACGGAGGTGCGCAGTGTGGG + Exonic
904280097 1:29413056-29413078 ACCACTGTGGAGGGAACTGTGGG + Intergenic
904606051 1:31698327-31698349 AAGAATGAGGTAGGTACTGGTGG + Intronic
905233938 1:36532593-36532615 AAACCTGAGGAGGGGACTGTGGG + Intergenic
907331198 1:53672802-53672824 AGCCCTGAGCTGGGTGCTGTGGG - Intronic
907611048 1:55871450-55871472 CAGACTGAGGTTTGTACTGTTGG + Intergenic
911417802 1:97597545-97597567 AACACTAAGGTAGGTATTGCTGG + Intronic
912500903 1:110121339-110121361 AAATCTGAGGTAGCTACTGTCGG + Intergenic
912591339 1:110824232-110824254 AACACTCTGATGGGTGCTGTTGG + Intergenic
915352876 1:155237395-155237417 GACATTGTGGTGAGTACTGTTGG + Exonic
915384587 1:155478463-155478485 AACACTGGGGTAGGTACTCATGG + Exonic
915544000 1:156585578-156585600 AACACAGCGCTGGGTGCTGTTGG + Intronic
915919721 1:159965615-159965637 AAAAATGAGGTGGGTGGTGTGGG - Intergenic
918437791 1:184534196-184534218 CACTGTGAGGTCGGTACTGTGGG + Intronic
922426627 1:225502643-225502665 AGCACTGAGCTAGGCACTGTAGG + Intronic
924444298 1:244114946-244114968 AACACTGTGCTGGGCATTGTAGG - Intergenic
924863275 1:247949573-247949595 TACAGTGAGGTGGGTGCTGCAGG - Exonic
924866747 1:247990983-247991005 TACAGTGAGGTGGGTGCTGCAGG - Intronic
924867736 1:248003846-248003868 TACAGTGAGGTGGGTGCTGCAGG - Intronic
924869223 1:248022663-248022685 TACAGTGAGGTGGGTGCTGCAGG - Exonic
924872274 1:248061397-248061419 TACAGTGAGGTGGGTGCTGCAGG - Exonic
1067684842 10:48459919-48459941 AACACTGAGCTGGGTGGTGGAGG - Intronic
1072266012 10:93728659-93728681 AACACTGAAGTGGTGACAGTGGG - Intergenic
1075513543 10:123091728-123091750 AACACTGACATGGCTCCTGTGGG + Intergenic
1078531793 11:12142195-12142217 AACAATGAGGTAGGAGCTGTGGG - Intronic
1081461401 11:43275755-43275777 AACATTGAGGTGGGTCTTTTGGG + Intergenic
1081890808 11:46540875-46540897 AACACTGTGCTAGGCACTGTGGG - Intronic
1085044247 11:73344081-73344103 GGCACTGAGGTGGGCACTGGGGG - Intronic
1085682609 11:78592208-78592230 AAAACTGAGGTGGTAACTGGTGG + Intergenic
1085739029 11:79063564-79063586 AGCACCGAGGTGGGTCCTGCTGG - Intronic
1087042701 11:93817440-93817462 AACACTGGGGAGGATACTGGGGG - Intergenic
1088885055 11:113999693-113999715 AACTCTGAGTTGGGTCTTGTAGG - Intergenic
1089638899 11:119834038-119834060 TTCACTGAGGTGGGGAATGTAGG - Intergenic
1093254842 12:16854324-16854346 AACACTGTGCTAGGTGCTGTAGG + Intergenic
1093977613 12:25440004-25440026 AAACCTGAGGTGGGGATTGTGGG + Intronic
1096807946 12:54151718-54151740 AAGACTGAGGTGGGAGCTCTGGG - Intergenic
1096980200 12:55724212-55724234 CACACTGAGGAGGGGACTGAGGG + Exonic
1100207808 12:92369960-92369982 AATACTGAGTTGTGTCCTGTTGG + Intergenic
1100823473 12:98453675-98453697 AAGACTGAGGTATCTACTGTGGG - Intergenic
1101289636 12:103354576-103354598 AACACTGTTCTGGGTACTGGAGG - Intronic
1101620798 12:106386000-106386022 AACACTGCATTGGGCACTGTGGG - Intronic
1104069672 12:125333514-125333536 AACACTGAGGAGGGCAGAGTTGG - Intronic
1105420413 13:20247371-20247393 GACACTCTGGTGAGTACTGTAGG - Intergenic
1106511740 13:30419152-30419174 AACACTGAAGGAGGTACTTTGGG - Intergenic
1106647020 13:31647343-31647365 AACAGTGATGAGGTTACTGTGGG - Intergenic
1107088776 13:36453400-36453422 AGCACTGAGGTGGGTGCTATAGG - Intergenic
1107484360 13:40812162-40812184 GACACTGAGCAGGGGACTGTGGG - Intergenic
1108023344 13:46152095-46152117 CACAGTAAGGTGGTTACTGTTGG + Intronic
1110775214 13:79400811-79400833 AACACTGAGGTAAGTAATTTTGG + Intronic
1112120681 13:96407640-96407662 AGCACTGTGCTGGGTGCTGTGGG + Intronic
1117134797 14:52724231-52724253 ACCATTGAGGTAGGTGCTGTAGG + Intronic
1118917576 14:70120816-70120838 AACACCGTGCTGGGTACTGGAGG + Intronic
1119281254 14:73410258-73410280 AAAACTGAGGTGGATAATATGGG + Intronic
1121812901 14:96907308-96907330 GGCACTGGGGTGGCTACTGTAGG - Intronic
1121848708 14:97198864-97198886 ACCACTGAGGGGTGTACAGTTGG + Intergenic
1124508866 15:30305352-30305374 AATGCTGAGGTGGGAACTTTAGG - Intergenic
1124734692 15:32233310-32233332 AATGCTGAGGTGGGAACTTTAGG + Intergenic
1125034262 15:35106002-35106024 GGCACTGTGGTGGGAACTGTGGG + Intergenic
1125326611 15:38541746-38541768 AGCACTGTGATAGGTACTGTGGG + Intronic
1125522042 15:40353712-40353734 ACCACTCAGGTGGGTGCTGCAGG + Intronic
1126412071 15:48382415-48382437 AACACTGTGGCTGTTACTGTTGG - Intergenic
1127257313 15:57303231-57303253 AAGACAGAGGTGGGTCCTGGAGG - Intergenic
1127563834 15:60167101-60167123 AACCCTGAAATAGGTACTGTTGG + Intergenic
1129330018 15:74822401-74822423 AACCCTGAAGTGGCCACTGTTGG + Intronic
1129457315 15:75682829-75682851 CACACAGAGGTGGGTGCTGAGGG - Exonic
1129726471 15:77904116-77904138 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1130274513 15:82469464-82469486 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1130466861 15:84196838-84196860 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1130497403 15:84476698-84476720 CACACAGAGGTGGGTGCTGAGGG - Intergenic
1130589155 15:85201431-85201453 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1131879465 15:96847180-96847202 AAAAAGGGGGTGGGTACTGTGGG - Intergenic
1132480300 16:163695-163717 GACAGTGAGGAGGGGACTGTGGG + Intronic
1132480327 16:163779-163801 GACAGTGAGGAGGGGACTGTGGG + Intronic
1133278749 16:4653170-4653192 AAGCCTGAGGAGGGGACTGTGGG - Intronic
1133590596 16:7239184-7239206 ACCATTGATGTAGGTACTGTGGG + Intronic
1135295239 16:21273926-21273948 TTCATTGAGGTGGGTGCTGTTGG + Intronic
1138117103 16:54369568-54369590 AACACTGAATTGGGGACTGCTGG - Intergenic
1138142433 16:54580445-54580467 AAGACTGAGGTGGGGAGAGTGGG - Intergenic
1142240926 16:88944663-88944685 AACCTTGAGCTGGGCACTGTTGG - Intronic
1144382582 17:14717433-14717455 GAGACTGAGGTGGCTACTGTTGG + Intergenic
1147059441 17:37862996-37863018 AGCACTGAGATAGGTAATGTTGG + Intergenic
1148408716 17:47445501-47445523 AGCACTGAGATAGGTAATGTTGG + Intergenic
1148699110 17:49577344-49577366 GACACTGGGGTGGGGACAGTAGG - Intronic
1149514778 17:57272364-57272386 ATCACAGAGCTGGGCACTGTTGG + Intronic
1149597421 17:57872564-57872586 AACACTGAGCTGGGGGCTGAGGG - Intronic
1152530140 17:80913839-80913861 ACCACTGAGGTGAGAACTGCTGG - Intronic
1152883120 17:82831716-82831738 AAAAGTGAGGCGGGTACTCTGGG + Exonic
1153222130 18:2871156-2871178 AACACTGTGGTTGGGAGTGTGGG + Intronic
1154150942 18:11905930-11905952 AGCACTGAGGTGGACACTGCGGG - Intronic
1155657060 18:28204750-28204772 AACACTGAGGTGGTAACTACAGG - Intergenic
1156837908 18:41577273-41577295 AAACTTGAGGTGGGTACAGTTGG + Intergenic
1157162794 18:45329721-45329743 AGCACTGTGCTGGGCACTGTGGG - Intronic
1157284099 18:46365291-46365313 AACCCTGAGTTGGGGAGTGTAGG - Intronic
1158367550 18:56755593-56755615 AAATGTGAGGTAGGTACTGTGGG + Intronic
1160497729 18:79384945-79384967 AACACCGAGGTGGCCACTGCAGG - Intergenic
1166154944 19:40903878-40903900 CACACTGAGGTGGGTCCTAATGG + Intergenic
926760891 2:16278141-16278163 AGCACTGAGGTGGGGACTGGAGG - Intergenic
928169209 2:28992506-28992528 ACCACTGAGGAGGCTACGGTGGG + Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932867081 2:75355039-75355061 AACTTTGAGGTAGGTACAGTTGG - Intergenic
933652675 2:84862062-84862084 GACCCTGAGGTGGTTACTGGTGG - Intronic
934944906 2:98533487-98533509 ATCATTGAGGTGGGTGCTGGTGG + Exonic
935632719 2:105225008-105225030 ATCACTCAGGTGGGTGCTGGGGG + Intergenic
936874843 2:117176182-117176204 GTGACTGATGTGGGTACTGTAGG - Intergenic
940051145 2:149466377-149466399 AGCACTGAGGTCTGTACTGCTGG + Intronic
941002982 2:160220948-160220970 ATCACTGAGGTGGGAACTGCAGG - Intronic
942512058 2:176713241-176713263 TACTATGAGGGGGGTACTGTGGG - Intergenic
942565021 2:177257617-177257639 AGCACTGAGGTGGGTCCCCTAGG + Intronic
944778378 2:202992965-202992987 AACACTGAGGTTTGTATTGTAGG - Intronic
946325672 2:218983650-218983672 ACGACTGAGATGGGGACTGTGGG + Intronic
946616182 2:221513131-221513153 AACACTGAGGTGGGTACTGTGGG + Intronic
946702643 2:222428125-222428147 TTCACTGAGGTGTGTCCTGTTGG + Intronic
947213742 2:227731173-227731195 GACACTGCGGTGGGCACAGTAGG + Intergenic
948445920 2:238032858-238032880 AACAGTGAGGTGGGGAATGAGGG + Intronic
948681206 2:239635888-239635910 ATGGCTGAGGTGGGTAATGTTGG - Intergenic
948929952 2:241125812-241125834 ACCACTGAGGTGGGGGCTGGTGG + Intronic
1168980525 20:1999632-1999654 AACTCTGAGGTGGGTTTTGAAGG + Intergenic
1169513626 20:6292847-6292869 AACATTGTTGTGGGTACTTTTGG + Intergenic
1169730086 20:8777195-8777217 AGGAGTGAGGTGGGAACTGTTGG + Intronic
1169744297 20:8927988-8928010 AATAAGGAGGTGGGTACAGTAGG + Intronic
1171110410 20:22475738-22475760 AACACTGTAGTGGGCACTGTTGG - Intergenic
1171438600 20:25142984-25143006 AACACTGAGGTGGCCAGTGCTGG + Intergenic
1173598026 20:44272310-44272332 AGCATTGAGGTGGGGAGTGTGGG + Intronic
1174440831 20:50551650-50551672 ACCACTGAGGTGTGGACTGGGGG + Intronic
1174935830 20:54867148-54867170 AACACTGTGGTGAGTTCTGTGGG - Intergenic
1175583397 20:60118121-60118143 AACAAAGAGGTGGGTAATGATGG + Intergenic
1181343514 22:22200870-22200892 GACACTGAGGTGGGGGCTGCAGG - Intergenic
1183075445 22:35423699-35423721 CTCACTGAGGAGGGTACTGTTGG + Intronic
1183646316 22:39129043-39129065 ATTATTGAGGTGGGTGCTGTGGG - Intronic
950320271 3:12045695-12045717 AGCACTGAGGTGGAGATTGTAGG - Intronic
951405861 3:22296616-22296638 AACACTGAGTTAGATACTGAAGG + Intronic
953449545 3:42994786-42994808 TACACTGTGGTGGATGCTGTCGG - Intronic
953615259 3:44484384-44484406 AACACTGAGTTGACTACTCTGGG + Intergenic
953957853 3:47245378-47245400 AAATCTGAGGTGAGTGCTGTCGG + Intronic
955589275 3:60516631-60516653 ACCTATCAGGTGGGTACTGTTGG - Intronic
956574581 3:70738079-70738101 AACACAGAGCTGGGTGCTGCTGG - Intergenic
959466633 3:106695584-106695606 AACACAGAGGTAGATAATGTGGG - Intergenic
960081301 3:113543334-113543356 AAAACTGAGGAGGGTTTTGTAGG - Intronic
963003388 3:140704170-140704192 AACACAGAGATGGGAACTGCAGG + Intergenic
965543246 3:169890925-169890947 AACACTGCTGTGGTTAATGTTGG + Intergenic
967433699 3:189419689-189419711 AAAACCGAGGTGGGTTCTGCTGG + Intergenic
970008552 4:11433437-11433459 AACACTGATGTGTGTAATTTTGG - Intergenic
970255132 4:14160180-14160202 AACACTAAGGTGGAAACTGTGGG - Intergenic
972770067 4:42189470-42189492 AACACTGAGTTGGATAATGAGGG - Intergenic
972770154 4:42190124-42190146 AACACTGAGTTGGATAATGAGGG - Intergenic
976640161 4:87329406-87329428 AACTCTTAGGTGGGAACTGATGG - Intergenic
985795015 5:1955837-1955859 TGCACTGAGATGGGGACTGTGGG + Intergenic
985795118 5:1956319-1956341 TGCACTGAGATGGGGACTGTGGG + Intergenic
985795152 5:1956479-1956501 TGCACTGAGATGGGGACTGTGGG + Intergenic
986896311 5:12373931-12373953 AGCACTGAGCTGGGTACTGGGGG + Intergenic
987297411 5:16566006-16566028 AACACTTGGGTGAGTACCGTGGG + Intronic
988800871 5:34695520-34695542 CAAACTGAGGTGTATACTGTAGG + Intronic
991617830 5:68515655-68515677 AACTCTCAGGTGGGAACAGTTGG - Intergenic
998483471 5:142482039-142482061 GACACTGTGGTGGCCACTGTAGG + Intergenic
999321015 5:150615121-150615143 TGCACAGAGGTGGGTGCTGTGGG + Intronic
1000055238 5:157600402-157600424 AACACTAGGGTGGAAACTGTGGG - Intergenic
1000295849 5:159912866-159912888 AACACTGAGCTAGGTGCTGTGGG - Intergenic
1001570397 5:172727089-172727111 ACCAGTGAGGTGGGCTCTGTAGG - Intergenic
1001825946 5:174745169-174745191 AATACTGTGGTGGGCACTGGAGG - Intergenic
1002420951 5:179148840-179148862 CAGACGGAGGGGGGTACTGTGGG + Intronic
1003168192 6:3699729-3699751 GACACTGAGTTGGGGACTGTGGG + Intergenic
1004496128 6:16164957-16164979 AGCACTGTGGTGGGTACTCAGGG + Intergenic
1011389422 6:86835762-86835784 GACACTCAGGTGGGTACAGGAGG - Intergenic
1012808449 6:103926450-103926472 AACCCTGTGATGGGCACTGTAGG + Intergenic
1012865885 6:104617252-104617274 AAGATTGAGGTGGGTACTTGTGG - Intergenic
1014051601 6:116961831-116961853 GACACTGTGCTGGGTACTTTAGG - Intergenic
1016718599 6:147265645-147265667 AATACTGAGGTGGGGCCTGGGGG + Intronic
1020646055 7:10815664-10815686 AACACTGTGGTAAGTACTATGGG + Intergenic
1025223748 7:57138748-57138770 AACACTGAGGTTGTGACTATTGG + Intronic
1025745915 7:64242667-64242689 AACACTGAGGTTGTGACTATTGG - Intronic
1030625825 7:111845064-111845086 ACCACTGAGTTGTGTACTCTTGG - Intronic
1032192767 7:129773989-129774011 AGGGCTGAGGTGGGAACTGTTGG + Intergenic
1032973742 7:137196723-137196745 AACACAGTGGTGAGTTCTGTGGG - Intergenic
1033135140 7:138777830-138777852 AACACAGAGGTGAGTTCTCTGGG + Intronic
1033979516 7:147146716-147146738 AACACTGAAGTGGGTTCAGGAGG + Intronic
1034694695 7:153043262-153043284 AGCAATGAGGTGGGGACTGGGGG + Intergenic
1034777481 7:153843385-153843407 AACTCTGAGGTTGCTATTGTGGG + Intergenic
1038574834 8:28696026-28696048 CACACTTAGGTGGGTAAGGTGGG - Intronic
1039220225 8:35321966-35321988 AACCATGAAATGGGTACTGTGGG - Intronic
1039253643 8:35694208-35694230 AACACTGAACTGGGGACTGTTGG + Intronic
1041413532 8:57582379-57582401 AAAACTGAGGAGGGAATTGTGGG + Intergenic
1044578386 8:93796409-93796431 AACACTGAGTTGGGGATTGGGGG - Intronic
1044933117 8:97269250-97269272 AACCCTGAGGTAGGTGCTGTGGG + Intergenic
1048266584 8:132992602-132992624 GACACTGTGGAGGGTGCTGTGGG + Intronic
1048620783 8:136130728-136130750 AACACAGAGGTGTCCACTGTAGG + Intergenic
1048949527 8:139483845-139483867 ATCACAGAGGTGGGAACTGCAGG - Intergenic
1050867653 9:10523421-10523443 AAGACTGAAGTGGGAACAGTAGG - Intronic
1051143939 9:14007279-14007301 CACTGTGAGGTGGCTACTGTGGG - Intergenic
1057363796 9:94399775-94399797 ATCACTGAGGTGAGTATTGCCGG + Intronic
1060000430 9:119953449-119953471 ATGGCTGAGGTGGGGACTGTGGG - Intergenic
1060317521 9:122526559-122526581 AACGCAGAGGTGGGAACTGCAGG + Exonic
1062099084 9:134718712-134718734 AGCTCTGGGGTGGGGACTGTGGG + Intronic
1062447562 9:136602035-136602057 AACCCTGAGTTGGGTACTGAGGG + Intergenic
1189770300 X:44418591-44418613 ACCACTGAGGTGGGGAGTGAAGG - Intergenic
1199074871 X:143515327-143515349 TACAGTGAGGTTGGTCCTGTCGG - Intronic
1200077468 X:153558295-153558317 ATTACTCAGGTGGGTACTGGGGG + Exonic
1200254614 X:154573434-154573456 AAAACTAATATGGGTACTGTCGG - Intergenic
1200263155 X:154630974-154630996 AAAACTAATATGGGTACTGTCGG + Intergenic