ID: 946616671

View in Genome Browser
Species Human (GRCh38)
Location 2:221517538-221517560
Sequence GGCCACCTGGACCAGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 2, 2: 1, 3: 56, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946616662_946616671 3 Left 946616662 2:221517512-221517534 CCCTTGAGATCCAGCAGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 194
Right 946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG 0: 1
1: 2
2: 1
3: 56
4: 368
946616664_946616671 2 Left 946616664 2:221517513-221517535 CCTTGAGATCCAGCAGAGAGGGC 0: 1
1: 0
2: 1
3: 16
4: 218
Right 946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG 0: 1
1: 2
2: 1
3: 56
4: 368
946616660_946616671 15 Left 946616660 2:221517500-221517522 CCTGTAAGGAGGCCCTTGAGATC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG 0: 1
1: 2
2: 1
3: 56
4: 368
946616666_946616671 -7 Left 946616666 2:221517522-221517544 CCAGCAGAGAGGGCATGGCCACC 0: 1
1: 0
2: 3
3: 20
4: 269
Right 946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG 0: 1
1: 2
2: 1
3: 56
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946616671 Original CRISPR GGCCACCTGGACCAGGGTGG AGG Intronic
900227316 1:1539427-1539449 GGCCTCCTGGTCCAGCCTGGAGG - Intronic
900286476 1:1903249-1903271 GGTTACCAGGACCAGGGGGGTGG - Intergenic
900302709 1:1985993-1986015 GGCCATGTGGACACGGGTGGTGG + Intronic
900356615 1:2268116-2268138 GGGCACCTGGGCCAGGGCTGCGG - Intronic
900523951 1:3119438-3119460 AGCCGCCTGGGCCAGGTTGGGGG + Intronic
900640529 1:3686092-3686114 GGCCACCTGTCCCTGGGTGTTGG + Intronic
900680692 1:3914732-3914754 GGCCGCCTGGAGCAGGGCCGAGG - Intergenic
900803358 1:4751275-4751297 GGCCACCTCCACCAGGGAAGAGG - Intronic
900899440 1:5506864-5506886 GGTCACCTTAGCCAGGGTGGGGG - Intergenic
900981875 1:6050328-6050350 GGCCACCTGGGCCATGGCCGAGG + Intronic
901058914 1:6462705-6462727 AGCCTCCTGGACCTGGGTGCTGG + Intronic
902237295 1:15065594-15065616 AGCCACGTGGAAGAGGGTGGGGG - Intronic
902368124 1:15990450-15990472 GGCCTCCTGGGCCAGGGTGCTGG - Intergenic
902374465 1:16023783-16023805 GGCCACCTGGGGCAGGGTATCGG - Exonic
902638543 1:17751123-17751145 GCCCATCTGGCCCAGGGAGGGGG - Intergenic
903028887 1:20448777-20448799 GCCCTCCTGGGCCGGGGTGGAGG - Intergenic
903226202 1:21895330-21895352 GGCCAGTCTGACCAGGGTGGGGG + Intronic
903261086 1:22132201-22132223 GGCCTCTTGGAGAAGGGTGGGGG + Intronic
903738430 1:25544428-25544450 TGCCACCTGGACCCGGCTAGAGG - Intronic
903846434 1:26282199-26282221 GACCAGCTGGGCCAGGGAGGGGG - Intronic
905800549 1:40839662-40839684 GGGCTCCTGGACCAGAGAGGAGG - Exonic
906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG + Intergenic
907271954 1:53296458-53296480 GGCCACTTGTACCCGGGTCGGGG + Intronic
907520557 1:55020775-55020797 GGCCACCTGCATCAGAGTGGTGG - Intergenic
907962981 1:59299681-59299703 GCACACCTGGACAAGGGTGGGGG + Intronic
908686847 1:66730499-66730521 GGTCACTTGGACAAGGGAGGTGG - Intronic
908714474 1:67054529-67054551 GGCCACCTGTAACAGAGGGGAGG - Intergenic
909495358 1:76271799-76271821 GGCAGCTTGGAGCAGGGTGGTGG + Intronic
909747277 1:79113214-79113236 GGAAACCTTGACCAGTGTGGGGG + Intergenic
910944370 1:92573516-92573538 GGCCACATTTACCATGGTGGGGG - Intronic
913166496 1:116191814-116191836 GGCGATCTGGATTAGGGTGGTGG + Intergenic
915111254 1:153565805-153565827 GGCATCCTGGACCGGGGTGAGGG + Exonic
915287805 1:154863991-154864013 CGCCACCCGCCCCAGGGTGGTGG - Intronic
915450985 1:156004977-156004999 GGACACCTGGAACATGCTGGTGG + Intronic
917531995 1:175843802-175843824 GGACACATGGACCGGGTTGGTGG - Intergenic
917603739 1:176603731-176603753 GGGGACCTGGATTAGGGTGGTGG - Intronic
917891302 1:179441022-179441044 GTCCACCTGGAGTAGGGTGAGGG + Intronic
918246723 1:182667075-182667097 GACCACCTGGGGAAGGGTGGGGG - Intronic
918887307 1:190211691-190211713 GGCCAACTGGAACAGGGAGAAGG + Intronic
922726161 1:227923995-227924017 GGCCTCCTGTAGGAGGGTGGAGG - Intronic
924707916 1:246513260-246513282 GGCCTCCTGGGCCAGGGTGCCGG + Intergenic
924946305 1:248849213-248849235 GGCCACCTCTGCCAGGGTGCAGG - Exonic
1066437166 10:35405729-35405751 AGCCCCCTGGACCATGATGGAGG - Intronic
1067508062 10:46873171-46873193 GGCCACGTTGACCATGGTGCAGG + Intergenic
1067654189 10:48178674-48178696 GGCCACGTTGACCATGGTGCAGG - Intronic
1069051325 10:63797951-63797973 AGCCACAGAGACCAGGGTGGAGG + Intergenic
1069866912 10:71509884-71509906 TGACAAGTGGACCAGGGTGGAGG + Intronic
1072199555 10:93145906-93145928 GGCCACAGGGACCAGGGAGCTGG - Intergenic
1072803648 10:98410573-98410595 GGGCACCTGGGGCGGGGTGGGGG - Intronic
1073301787 10:102475400-102475422 GGAGACTTGGGCCAGGGTGGTGG + Intronic
1074291416 10:112140384-112140406 CCCCGCCTGGACCAGGGTGCAGG - Intergenic
1074412733 10:113242336-113242358 TGTCACCTGGGCCTGGGTGGAGG + Intergenic
1074923706 10:118046475-118046497 GGCCACACGGACCCGGGCGGAGG + Exonic
1074960131 10:118437200-118437222 GGTAACTTGGACCGGGGTGGTGG - Intergenic
1075120169 10:119659064-119659086 GGCCACCTGGACACTGGTCGGGG - Intronic
1075572357 10:123555625-123555647 GTCCACCTGGCCCACGGTTGGGG - Intergenic
1075800257 10:125149347-125149369 CTCCACCTGGAAGAGGGTGGTGG - Intronic
1076816989 10:132919918-132919940 GGCCACCTGCTCCAGGATGGTGG - Intronic
1077018691 11:407905-407927 GGCCAGCAGGACCAGGAGGGAGG + Exonic
1077086873 11:757262-757284 GGCCATCTGGACATGGGTGCAGG - Intronic
1077298542 11:1837074-1837096 GCCCACCTGGACCTGGCTGAAGG - Exonic
1077374053 11:2197406-2197428 GGCCACCTGGACATGGGACGAGG - Intergenic
1078479529 11:11663924-11663946 GCCCACCTGGGCCAGGTAGGAGG + Intergenic
1078634847 11:13039719-13039741 GATCACCTGGGCAAGGGTGGTGG + Intergenic
1078721571 11:13889532-13889554 GCCCAACTGCACCAGGCTGGGGG - Intergenic
1078927372 11:15886829-15886851 AGCCACCTGCATCAGGCTGGTGG + Intergenic
1079097208 11:17518620-17518642 GGCCCCCTGGGGCAGGTTGGGGG + Intronic
1079153581 11:17923561-17923583 TGGGGCCTGGACCAGGGTGGAGG + Intronic
1081044031 11:38250031-38250053 GGGCACCTGCATCAGGGTGAAGG + Intergenic
1081330508 11:41794272-41794294 GCACACCTGGGCCAGGGGGGAGG - Intergenic
1081582552 11:44362225-44362247 GGCGACCTGGACCTGGGGGTTGG + Intergenic
1081829614 11:46097087-46097109 GGTGACTTGGACCAGGGAGGTGG - Intronic
1081867298 11:46366838-46366860 GGCCCCCAGGGCCAGGGTGCTGG - Exonic
1081996642 11:47369352-47369374 GGTGACCTGGACAAGGGTGGTGG - Intronic
1083442750 11:62687912-62687934 GGCCGCGTGGACCAGAGTGCGGG + Exonic
1083720497 11:64601376-64601398 GGCCCCCGAGAGCAGGGTGGTGG + Intronic
1083999989 11:66290863-66290885 GGCCACGTGTACCTGGGAGGGGG + Intergenic
1084285654 11:68128827-68128849 CGCCACGTGGACGGGGGTGGTGG + Intergenic
1084486858 11:69453312-69453334 GGGCACATGGACCAGAGCGGGGG - Intergenic
1084704362 11:70807166-70807188 GGCGACCTGGACCAGGTGAGAGG + Intronic
1085401748 11:76239752-76239774 GCCAGCCTGGGCCAGGGTGGTGG - Intergenic
1086123531 11:83326437-83326459 TGCCACCTGGGCCAAGGTGCAGG - Intergenic
1087004676 11:93458240-93458262 GGCGAGCTGAAGCAGGGTGGGGG + Intergenic
1088597672 11:111452093-111452115 GCACACCTGGATCAGTGTGGTGG - Intronic
1089172668 11:116526245-116526267 GGGCATCTGGGCCAGGGAGGGGG - Intergenic
1089274916 11:117328178-117328200 GGCCACCGGGCCCGGGCTGGGGG + Intronic
1089497261 11:118914031-118914053 TGGCACCTGCACCAGGGTGGGGG + Intronic
1089582346 11:119489300-119489322 GTCCTGATGGACCAGGGTGGGGG + Intergenic
1089605334 11:119638284-119638306 GGCCACCTGGAGCAGGGGCATGG - Intronic
1089672163 11:120064063-120064085 GGACACCTGGAGCAGGGCAGAGG + Intergenic
1090371409 11:126256177-126256199 AGTCACTTGAACCAGGGTGGTGG + Intronic
1091273991 11:134337776-134337798 GGCCACTTGGAGGAGGGTGGAGG + Intronic
1091447469 12:552225-552247 AGCTGCCTGGACCAGGGTGATGG + Intronic
1095130750 12:38539436-38539458 GGTGACTTGGACCAGAGTGGAGG + Intergenic
1096615926 12:52833676-52833698 GCCCACTTGTACTAGGGTGGTGG - Intronic
1097019122 12:56007626-56007648 GGCCGCCCGGGCCAGAGTGGGGG + Intergenic
1101381062 12:104214597-104214619 GGCCACCTGGCCCAAGCTGAAGG + Intergenic
1102965770 12:117124396-117124418 GGTGGCTTGGACCAGGGTGGTGG + Intergenic
1104109135 12:125689078-125689100 AGCCACCAGGACCAGGGGAGGGG + Intergenic
1104468162 12:129006704-129006726 GAGCACCTGAACCCGGGTGGGGG + Intergenic
1104573363 12:129944836-129944858 GGTGTCCTGGACCAGGGTGGTGG - Intergenic
1104753639 12:131255495-131255517 GGCCACCTGGGTCAGGTAGGTGG - Intergenic
1104919155 12:132281707-132281729 GGCCACCTACACCTGGGGGGAGG + Intronic
1104975124 12:132548775-132548797 GGGCACCTGGACGGGGGTGAGGG + Intronic
1105266359 13:18821236-18821258 GGCCACGTGGATCAGTCTGGAGG + Intergenic
1106295874 13:28413150-28413172 GGCTCCCTGGACAATGGTGGAGG + Intronic
1108478390 13:50843299-50843321 CGCCATCTGGGCCAGGGTGCAGG + Exonic
1109955199 13:69556969-69556991 GGCCACCTTGTGCAGGGAGGAGG + Intergenic
1111708312 13:91779445-91779467 GATCACCTGAGCCAGGGTGGCGG - Intronic
1113992064 14:16035588-16035610 GGCCAGCTGGAGGAGGGTGGCGG - Intergenic
1115167768 14:30468722-30468744 GGCTGCCTGGAGCCGGGTGGGGG + Intergenic
1116582835 14:46663731-46663753 GGTCACGTGGTCCAGGATGGTGG + Intergenic
1116761251 14:49017971-49017993 TGCCACCTGGATCAGGATGCTGG - Intergenic
1117920644 14:60723091-60723113 GGGCAGCCGGACCAGGCTGGTGG + Intronic
1118229737 14:63936848-63936870 GGTGACTTGGGCCAGGGTGGTGG + Intronic
1121113904 14:91330606-91330628 GGGCACCTGGACCTGGGACGAGG + Intronic
1121251809 14:92505320-92505342 GGCCACCCGATTCAGGGTGGAGG + Intergenic
1121813647 14:96912946-96912968 GGTGACGTGGACCAGGGTGATGG + Intronic
1122138415 14:99647656-99647678 GGCCTCCTGGAGCATGCTGGCGG + Intronic
1122548789 14:102539107-102539129 GCCCACCAGGGCCAGGGTGGGGG - Intergenic
1122614846 14:103010198-103010220 GGTCACCTGAGCCTGGGTGGTGG + Intronic
1122975018 14:105167537-105167559 GGCCACCGGGAGCGGGGTCGCGG - Intronic
1122977635 14:105177462-105177484 GGCCACCGGGACCATGATGGTGG - Intronic
1123164638 14:106314735-106314757 GGGGACATGGACCTGGGTGGAGG + Intergenic
1123397894 15:19955393-19955415 GGGGACATGGACCTGGGTGGAGG + Intergenic
1124449241 15:29770344-29770366 AATCACCTGGACCAGGGAGGCGG + Intronic
1124666300 15:31595784-31595806 AGCCACCTGGAACAGGGTCCTGG - Intronic
1125897001 15:43310806-43310828 GGAGACCTGGACCAGGGCAGCGG + Intergenic
1127839680 15:62820313-62820335 GGCCATCTGGATGGGGGTGGGGG - Intronic
1128472466 15:67967016-67967038 GGTCACCTGAACCTGGGAGGTGG - Intergenic
1128812196 15:70580806-70580828 GGCCACCAGGAGCAGGGGTGTGG + Intergenic
1129265901 15:74392917-74392939 GGGGGCCTGGCCCAGGGTGGGGG - Intergenic
1129364092 15:75043823-75043845 AACCACGTGGACAAGGGTGGTGG - Intronic
1129892789 15:79082615-79082637 GCCAACCTGGACCACAGTGGTGG + Intronic
1130134714 15:81172995-81173017 GGCCAGCTGGAAAAGGGTGATGG - Intronic
1131277139 15:90991741-90991763 GGTGACCTGGACCAGGGTGGGGG - Intronic
1132226168 15:100143106-100143128 AGCCTCCAGGACCAGGGTGGTGG + Intronic
1132404714 15:101535419-101535441 GACCACAGGGCCCAGGGTGGTGG + Intergenic
1132792834 16:1702468-1702490 TGCCACCTGGTACAGGGTGAGGG + Intergenic
1133025475 16:2987331-2987353 GGCCTTCTGGACCAGGGTGCAGG + Intergenic
1133028427 16:2998528-2998550 GGCCACTGGGACCAGGGGTGGGG + Intergenic
1133792798 16:9022205-9022227 GGCCACATGCACCAAGATGGTGG + Intergenic
1134095355 16:11415141-11415163 AGCCACCTGGCCCTGGCTGGAGG + Intronic
1134100767 16:11449894-11449916 GGCGGCCTGGCCCGGGGTGGTGG - Intronic
1135798345 16:25468314-25468336 GGCCACCTGAACCTGGGAGGCGG - Intergenic
1138216274 16:55207749-55207771 GGGCAACAGGACCTGGGTGGTGG - Intergenic
1138497347 16:57416454-57416476 AGCCCCCTGGCCAAGGGTGGGGG + Intergenic
1139734319 16:68974186-68974208 ATCCACCTGGAAAAGGGTGGAGG + Intronic
1140506919 16:75479337-75479359 GGCCTCCCGGGCCAGGGTGAAGG + Exonic
1141203413 16:81914382-81914404 TGCCACCTGGCTCAGGGAGGGGG - Intronic
1142033832 16:87851791-87851813 GGCATCCTGGACCCGGGTGGCGG + Exonic
1144657197 17:17044058-17044080 GGCCGACTGGAGTAGGGTGGTGG + Intronic
1145005746 17:19336829-19336851 GGGCACTAGGACCAGGCTGGTGG - Intergenic
1145760929 17:27425252-27425274 GGCCTCCTGGGCCAGGGTGCCGG - Intergenic
1146142510 17:30379666-30379688 GGGCACCTCGTCCAGGGCGGGGG - Exonic
1146160969 17:30559409-30559431 GGCCTCCTGGGCCAGGGTGCCGG - Exonic
1146632791 17:34482974-34482996 GGGCAGCTGGACCTGGGAGGGGG + Intergenic
1147256440 17:39184953-39184975 GGGCTCTGGGACCAGGGTGGGGG - Intronic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1147364668 17:39952279-39952301 GCCTACCTGGAACAGCGTGGTGG - Intergenic
1147493255 17:40891868-40891890 GGCTACGTGGTCCAGTGTGGGGG + Intergenic
1147725353 17:42563333-42563355 GGGACCCTGGACTAGGGTGGAGG + Intronic
1147735015 17:42631131-42631153 AGCCACATGGCCCAGCGTGGTGG + Intergenic
1148106944 17:45123962-45123984 GGCTACCTGGACCTGGTTGGGGG - Intronic
1148816071 17:50329134-50329156 GGCCAGCTGGTCCATGCTGGGGG + Intergenic
1150123142 17:62619751-62619773 AGCCTCCTGGGACAGGGTGGAGG + Intergenic
1150554166 17:66238646-66238668 AGCCACCTGCACCTGGCTGGGGG - Intronic
1151344772 17:73494821-73494843 GGCCTCCCAGGCCAGGGTGGGGG + Intronic
1151477478 17:74352303-74352325 GGCCACTTGGTCCATGATGGTGG - Exonic
1151574196 17:74943393-74943415 GGCCACCCTGACCAGGGAAGTGG - Intronic
1151711941 17:75812095-75812117 GGGCACCTGGAACACGGTAGTGG - Exonic
1151942992 17:77304552-77304574 GTCCATCTGGCCCAGGGAGGAGG + Intronic
1152218751 17:79049396-79049418 GACCAGCTGGAGCAGGGTTGCGG + Exonic
1152341788 17:79729677-79729699 GGTGGCCCGGACCAGGGTGGTGG - Intergenic
1152383765 17:79956539-79956561 GACCACCGGGCCCAGCGTGGTGG - Intronic
1152555737 17:81052363-81052385 GGCCACGTGCACGGGGGTGGGGG - Intronic
1152778003 17:82214010-82214032 GGACACATGGGCCAGGTTGGGGG - Intergenic
1152779385 17:82219580-82219602 GGCCACCGGCACCTGGGAGGCGG - Intergenic
1152797836 17:82316668-82316690 TGTCACCAGGACCAGGGTGCCGG + Exonic
1152814613 17:82400042-82400064 GGCCACCTTGCCCAGGGGGAGGG - Intronic
1154422054 18:14240239-14240261 GGCCACGTGGATCAGTCTGGAGG - Intergenic
1157616356 18:48990003-48990025 CGCCCCCTGCTCCAGGGTGGGGG + Intergenic
1157842069 18:50968050-50968072 GGACAGCTGGGCCAGGGTGCGGG + Exonic
1160024653 18:75208197-75208219 GGGCAGCTGGGCCAGGGTCGGGG - Intronic
1160269169 18:77368343-77368365 GGCAACATGGCCCAGCGTGGTGG - Intergenic
1160484326 18:79274982-79275004 GGCCACTGGGCTCAGGGTGGTGG - Intronic
1160771072 19:831495-831517 GGGCACCTGGCCCAGCCTGGAGG + Intronic
1160789879 19:918440-918462 GGTCACTCGGACCAAGGTGGGGG + Intronic
1161225163 19:3141085-3141107 GGCAAAAAGGACCAGGGTGGGGG + Intronic
1161267329 19:3370281-3370303 GGCCACCAGGCCCCGGGTGGGGG - Intronic
1161404631 19:4084534-4084556 GGCCACGTGGCCAGGGGTGGAGG - Intergenic
1161744336 19:6046100-6046122 GGCCACATGAAACAGGCTGGAGG - Intronic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1162437587 19:10671489-10671511 GGCCACCTTGTCCAGGAGGGCGG - Exonic
1162792909 19:13072216-13072238 GACCAGGGGGACCAGGGTGGGGG + Intronic
1163277727 19:16296009-16296031 GGCCTCCTGGTCCAGAGTGGCGG - Intergenic
1163651171 19:18518878-18518900 AGCCAGCTGGAGCAGCGTGGTGG - Intronic
1164547512 19:29181224-29181246 GGCCACCTGCACCACACTGGCGG + Intergenic
1164912114 19:32021283-32021305 GGCCACATGTGCCAGGGAGGAGG - Intergenic
1165093461 19:33398132-33398154 GGCCACGGGGAGCAGGGCGGCGG - Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166220263 19:41359844-41359866 GGCCACGTGGGCCATGGTGGAGG - Intronic
1166318509 19:42002433-42002455 GGCAACCTGGACACGGGTGGAGG + Intronic
1166393040 19:42420676-42420698 TACCGCCTGGACCAGGGAGGAGG - Intronic
1166668914 19:44698223-44698245 GGTCACCTAGACCAGGGCAGGGG + Intergenic
1166917178 19:46203399-46203421 GGCCAACTGTACCGGGGTGTTGG - Intergenic
1167043892 19:47039060-47039082 GCGCTCCTGGACCAGGGAGGAGG - Exonic
1167131333 19:47588015-47588037 GGTGGCCTGGACCAGTGTGGAGG - Intergenic
1167158391 19:47752805-47752827 GGGCACCTGGCCCAGCCTGGGGG + Intronic
1168119473 19:54243540-54243562 GACCACCTGGGCCCGGGAGGCGG + Intronic
1168230755 19:55029759-55029781 GGCCACTTTGACTAGGGTGGTGG + Intronic
1168321342 19:55511833-55511855 GGCCTCCAGGATCAGTGTGGGGG + Intronic
925386921 2:3468355-3468377 GAGCAGCTGGACCAGGGTCGGGG - Intronic
925395427 2:3529965-3529987 GACCACCCAGTCCAGGGTGGGGG - Intergenic
926095242 2:10077161-10077183 GGTCATTTGGACCAGGTTGGCGG - Intronic
927884258 2:26708904-26708926 GGCGGACTGGACCAGCGTGGTGG + Intronic
928123298 2:28599298-28599320 GGCCTCTAGGAGCAGGGTGGGGG - Intronic
928444542 2:31321229-31321251 GACCAGGTGGACCACGGTGGTGG - Intergenic
930719762 2:54627788-54627810 GGCCAGCGGGGCCAGGGTGGGGG - Intronic
931248441 2:60510066-60510088 GGTGGCGTGGACCAGGGTGGTGG - Intronic
931785058 2:65611065-65611087 GGCCACTGGGGCCAGTGTGGAGG - Intergenic
932419053 2:71590733-71590755 GGCAGCCTGGATCTGGGTGGGGG - Intronic
932814928 2:74853889-74853911 GGCTACCTGGCCTAGGGTGAGGG + Intronic
934651996 2:96098148-96098170 TGCCATCTAGGCCAGGGTGGTGG - Intergenic
935011202 2:99137720-99137742 GGTGACTTGGACCAGGGAGGTGG + Intronic
936031095 2:109071121-109071143 AGCATCTTGGACCAGGGTGGTGG + Intergenic
936674806 2:114702581-114702603 GGCCTCATGGACCAGGGAGAAGG - Intronic
941893457 2:170606027-170606049 GGTTATCTGGACCAGGGTTGTGG - Intronic
942245558 2:174004644-174004666 TGCAACCTGGCCCAGGGTGGTGG + Intergenic
942449510 2:176100247-176100269 AGCCCCCTGGAGCAGGGTCGTGG - Exonic
942851615 2:180494472-180494494 TGCCACCTATAGCAGGGTGGTGG + Intergenic
946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG + Intronic
946688794 2:222295690-222295712 CGCCACCTGGCCCAGGGTACCGG - Intronic
947393830 2:229667512-229667534 GGTCACGTGTACCAGGGTGATGG + Intronic
948232100 2:236356195-236356217 GGCCCCCTGGATCTGGGTCGAGG - Intronic
948232345 2:236359125-236359147 GGCCCCCTGGATCTGGGTCGAGG + Intronic
948452151 2:238082431-238082453 GCCCACATGGGGCAGGGTGGGGG + Intronic
1168970757 20:1929304-1929326 GGTGACCTGGACCAAAGTGGTGG + Intronic
1171906730 20:30905455-30905477 GGCCAACCGGAGGAGGGTGGCGG - Intergenic
1172511675 20:35505072-35505094 TGCCACAGGGCCCAGGGTGGTGG - Intronic
1173663531 20:44750348-44750370 GGCCCCGAGGGCCAGGGTGGCGG - Exonic
1173941309 20:46913599-46913621 GGTGACTTGGACCAGGGTGGTGG + Intronic
1174040210 20:47694215-47694237 GGAGGCCTGGGCCAGGGTGGCGG + Intronic
1174102892 20:48140521-48140543 GGCCAACGGTAACAGGGTGGGGG - Intergenic
1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG + Intergenic
1174200164 20:48801606-48801628 GGTGTCCTGGCCCAGGGTGGTGG - Intronic
1174306672 20:49618351-49618373 AGCAGCCTGGACCAGGGTGGTGG - Intergenic
1174364524 20:50048494-50048516 GGGCACCTGGGCCAGGCTGCTGG + Intergenic
1174461281 20:50684686-50684708 GGCCGCTGGGACCAGGGTGGAGG + Intronic
1174668987 20:52288364-52288386 GGCAGCCTGGACCAAGGTGGTGG + Intergenic
1175183675 20:57165800-57165822 GGCCACCTGCTCCTGGATGGGGG + Intergenic
1175251213 20:57611129-57611151 GGCCAACTGGAGCAGGGTGATGG - Intronic
1175584064 20:60123475-60123497 GCCCACCTGGAAGAGGGTGAAGG - Intergenic
1175846297 20:62060727-62060749 GGAGGCCTGGACCTGGGTGGAGG - Intronic
1176180424 20:63747147-63747169 GGGCCCCTGGACCATGGCGGCGG - Exonic
1176270584 20:64233833-64233855 GGCCCGCTGGACAAGGTTGGAGG + Intronic
1176287019 21:5023659-5023681 GGCTTCCTGGGCCAGGGTGGGGG - Intronic
1176744576 21:10640115-10640137 GGGGACATGGACCTGGGTGGAGG + Intergenic
1176851428 21:13919715-13919737 GGCCACGTGGATCAGTCTGGAGG + Intergenic
1178841554 21:36141695-36141717 GGCCACCTGGACCTCAGTGGAGG + Intronic
1179870162 21:44239816-44239838 GGCTTCCTGGGCCAGGGTGGGGG + Intronic
1180315207 22:11271939-11271961 GGCCAGCTGGAGGAGGGTGGCGG + Intergenic
1180568512 22:16695507-16695529 GGCAACGTGGGCCAGGGAGGAGG + Intergenic
1181084416 22:20432670-20432692 GGGCTCAGGGACCAGGGTGGAGG + Intronic
1182018759 22:27063307-27063329 GGCCACCTAGGGCAGGGTGGGGG - Intergenic
1182355193 22:29719775-29719797 AGCCACCAGGACCAGGGAGGGGG - Intergenic
1182529603 22:30945041-30945063 GGCCACCTGGAGAAAGGTGGTGG - Intronic
1183121251 22:35731808-35731830 GGTGACCTGAACCAGTGTGGTGG + Intergenic
1183875248 22:40774956-40774978 GGTGGCCTGGACCACGGTGGTGG - Intronic
1184276752 22:43413055-43413077 GGTCAGCTGGACAGGGGTGGGGG - Intronic
1184378364 22:44129425-44129447 GGCCACGTCACCCAGGGTGGAGG - Intronic
1184569316 22:45311755-45311777 GGTGACCTGGACCAAGGCGGTGG + Intronic
1184591245 22:45484866-45484888 GGCAACCTGGAGCCGGGTTGGGG - Intergenic
1184664909 22:45983181-45983203 GTCCACATGGAGCAGGGTGAAGG - Intergenic
1184927546 22:47653846-47653868 GGCCGCCTGGACAGTGGTGGTGG + Intergenic
1184987203 22:48144040-48144062 GGGCACCTGGCCCTTGGTGGTGG + Intergenic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185097677 22:48820654-48820676 GGCTGCCTGCACCACGGTGGGGG + Intronic
1185149280 22:49154721-49154743 GGACACGTTGACCATGGTGGGGG + Intergenic
1185268858 22:49919057-49919079 GGACTCCAGGACCACGGTGGAGG - Intronic
949898752 3:8792646-8792668 GGCCAGCAGGATCAGGGAGGAGG - Intronic
950534005 3:13569118-13569140 GGGGACTTGGGCCAGGGTGGAGG + Intronic
950906164 3:16540438-16540460 GGCAGCCTGGACCAAGATGGTGG + Intergenic
953143370 3:40249900-40249922 GGCCACCTGGCTCAGCATGGGGG - Intronic
953181361 3:40597905-40597927 GGCCACCTTGCCCAGAGAGGAGG + Intergenic
956244652 3:67168883-67168905 GGTGACCTGGACTAGGGAGGTGG - Intergenic
956253801 3:67262720-67262742 GGCAACCTGGACATGGGTAGTGG + Intergenic
957208331 3:77228577-77228599 GTCCACCTGTCCCAGGGTTGGGG + Intronic
959527519 3:107394202-107394224 TGCCAAATGTACCAGGGTGGGGG + Intergenic
960097070 3:113699059-113699081 TGCCTCCTGGAGCAGGATGGGGG - Intergenic
961212883 3:125139587-125139609 GGCCACCAGGTTCAGGGTGTGGG - Intronic
961457164 3:127029984-127030006 GACCACCTGGACCAGCGTGAGGG + Exonic
961533838 3:127557181-127557203 GGCAGCGTGGACCAGGCTGGTGG + Intergenic
962145203 3:132833308-132833330 GGCCTCCTGGACCCAGGAGGTGG + Intergenic
962408517 3:135121023-135121045 AACCACCTGGACCAGACTGGAGG - Intronic
962732740 3:138298863-138298885 GGACACCTGCGCCAGAGTGGCGG + Intronic
962840833 3:139230913-139230935 GGCTGCCTGGACTTGGGTGGAGG + Intronic
964255123 3:154766843-154766865 GGCCTCCTGATCCAGGGTGCAGG - Intergenic
964619224 3:158704159-158704181 GGTGGCTTGGACCAGGGTGGTGG - Intronic
967254297 3:187574004-187574026 GGCCACCTGGATCAGCCTTGGGG + Intergenic
968422624 4:498272-498294 GGCAACTTGGAACAGGGAGGGGG + Intronic
968509294 4:988305-988327 GGCCACCTGCACCAGCGTCAGGG - Exonic
968572773 4:1350990-1351012 GATCACTTGGACCAGGGAGGCGG - Intronic
969112048 4:4850332-4850354 GGGCAGCTGCACCCGGGTGGTGG - Intergenic
969301621 4:6300487-6300509 GGCCACCTGGAGAAGGGGGGAGG + Intronic
969456138 4:7300744-7300766 GGCCAGCGGGACCAGGGTCACGG - Intronic
975599156 4:76081352-76081374 GGCCATATGGACAAGGGAGGGGG + Intronic
977749233 4:100588847-100588869 TGACACTTGGACCAGGGTGGTGG - Intronic
978344647 4:107754480-107754502 GGCCACCTGGACAAGGAGAGGGG - Intergenic
978382069 4:108139560-108139582 GGCCAGCAGGGCCAGGGTGGAGG - Intronic
980954197 4:139411448-139411470 GATGGCCTGGACCAGGGTGGTGG + Intronic
981691321 4:147512857-147512879 GGTCACCAGGTGCAGGGTGGTGG - Intronic
985490148 5:174324-174346 GGCCAGCAGGGCCGGGGTGGGGG + Intronic
985533566 5:448325-448347 TGCCAGCTGGCCCTGGGTGGTGG + Intronic
985895298 5:2746981-2747003 GTCCACTTGGACATGGGTGGAGG + Intronic
986575496 5:9208583-9208605 GGCCACCCAGACAAGGATGGGGG + Intronic
987355469 5:17059862-17059884 GGTGGCCTGGACCAGGTTGGTGG + Intergenic
990879190 5:60520746-60520768 GGCCTCCTGGGCCAGGGCCGTGG - Intronic
992747652 5:79835258-79835280 GGCCACCTGGACCAGGCTGGTGG - Intergenic
994052545 5:95379290-95379312 GCCTACCAGGACCAGGCTGGTGG - Intergenic
994149841 5:96434385-96434407 GGCCAGCTGCAGAAGGGTGGAGG - Intergenic
994366894 5:98928090-98928112 GGACTCCTGGACCGGGATGGAGG - Intronic
994760052 5:103841021-103841043 AGCCATGTGGATCAGGGTGGTGG - Intergenic
995799530 5:115979060-115979082 AGCCACCTGGAGGAGGCTGGAGG - Intronic
996535143 5:124570046-124570068 GGACGCCTGGACCACGGTGGAGG + Intergenic
997273929 5:132566554-132566576 GGCAGCCTGGACAAGGGTTGAGG - Intronic
997607363 5:135184829-135184851 GGCCGCCTGGACCAAGGCAGCGG - Intronic
997825974 5:137107066-137107088 GGCCACCTCAACCAGTTTGGAGG - Intronic
998793680 5:145793928-145793950 GACCACATGGACCAGGGTTAGGG - Intronic
999245204 5:150150558-150150580 AGCCTCCTGCACCAGGCTGGGGG + Intronic
999256081 5:150210655-150210677 GGCCACCAGGACAAGGGAGATGG - Exonic
999305301 5:150515703-150515725 GCCCAGCAGGCCCAGGGTGGTGG + Intronic
1001753435 5:174148438-174148460 GGCCACTGAGACCAGGGAGGGGG - Intronic
1002521300 5:179794460-179794482 GACCACGTGGAGCAGGGTAGAGG + Intronic
1002932399 6:1643634-1643656 GACCACCTGGGCCACGGTGGGGG + Intronic
1003241666 6:4350607-4350629 GCACACCTGGACAAGGGTGGTGG + Intergenic
1003578034 6:7315318-7315340 GGCCAACTGGGCCAGGCGGGGGG + Intronic
1004159642 6:13202117-13202139 GGCCAGCTGGACCAAGTTAGTGG - Intronic
1004426386 6:15510098-15510120 GCCCGCCTGGACCTGGGGGGCGG + Intronic
1004621832 6:17337398-17337420 GATCACCTGAACCAGGGAGGTGG + Intergenic
1004821391 6:19371859-19371881 ACACACCTGTACCAGGGTGGTGG + Intergenic
1005274100 6:24198351-24198373 GGCGAGCTGAAGCAGGGTGGGGG + Intronic
1006060364 6:31414412-31414434 GGCCTCCTCGAGCAAGGTGGGGG + Intronic
1006072806 6:31509183-31509205 GGCCTCCTCGAGCAAGGTGGGGG + Intronic
1006130361 6:31865424-31865446 AGCTGCCTGGACCAGGATGGGGG + Intronic
1010318419 6:74477738-74477760 GACCACCTCTACCAGGGTGGTGG - Intergenic
1016373683 6:143399071-143399093 AGGTACCTGGCCCAGGGTGGTGG - Intergenic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1017505811 6:155067725-155067747 GACCACCTGAGCCAGGGAGGTGG - Intronic
1017995853 6:159531210-159531232 CACCACCTGGACCAGGGTCTGGG - Intergenic
1018223663 6:161606938-161606960 GGCCACCTGGCACAGCATGGGGG + Intronic
1018797324 6:167196444-167196466 GGCGGCCTGTGCCAGGGTGGAGG - Intronic
1018818973 6:167358320-167358342 GGCGGCCTGTGCCAGGGTGGAGG + Intronic
1019411527 7:908856-908878 GGCCACCTCGCCCACGGGGGTGG + Intronic
1019441667 7:1050568-1050590 GTCCGCCTGCACCAGGGTGCAGG - Intronic
1019473547 7:1233418-1233440 GGCCGCCTGGATCCGGGGGGGGG - Intronic
1019536804 7:1533597-1533619 GGGCACCAGGATCAGGGTGAGGG + Intronic
1019537719 7:1537792-1537814 GGCTCCCTGGCCCAGGGTGTGGG + Intronic
1019775894 7:2912091-2912113 GGCCACCTGGGCCAGGGACAAGG - Intronic
1020092385 7:5348934-5348956 GGCCAATTTGAGCAGGGTGGTGG + Intronic
1020265745 7:6558970-6558992 GGCATCTTGGACCAGGGTGGTGG - Intergenic
1020326651 7:6979498-6979520 GGCCAGATGGTCCAGGTTGGGGG + Intergenic
1023280481 7:38564416-38564438 GGCCACCTGGACCTGGTAAGAGG + Intronic
1025260954 7:57417098-57417120 GAGGACCTGGACCAGGCTGGGGG + Intergenic
1026295376 7:69047565-69047587 GGCACCGTGCACCAGGGTGGTGG - Intergenic
1026337578 7:69407908-69407930 GGTCACCTGAACCCGGGAGGCGG + Intergenic
1026439826 7:70434430-70434452 GGCCACCTGGACATGGGAGTTGG - Intronic
1026986620 7:74559136-74559158 AGCCACCTTGTCCAGGGGGGAGG - Intronic
1028527691 7:91803542-91803564 GGCCAATTCGACCAGTGTGGTGG + Intronic
1029444841 7:100606039-100606061 GGCCACCTGGCCAGGGGTAGTGG + Intronic
1029701988 7:102253243-102253265 GGCCACCTGGGCTTGGGCGGTGG - Exonic
1030551525 7:110967399-110967421 TGACACCAGGATCAGGGTGGGGG - Intronic
1031688819 7:124764611-124764633 GGCCACCTGGCCCCTGGAGGTGG - Exonic
1032285632 7:130536754-130536776 AGGCACCGGGACCATGGTGGTGG + Intronic
1032776086 7:135114672-135114694 GGTAGCTTGGACCAGGGTGGTGG - Intronic
1032779975 7:135157742-135157764 AGCCACCTGTAGCAGGGTGGTGG + Intronic
1033315554 7:140294405-140294427 GGCCAGCTGCTTCAGGGTGGTGG + Intronic
1033620392 7:143057312-143057334 GGCCACCTGTCTCAGTGTGGTGG - Intergenic
1034983230 7:155491432-155491454 GGCTCCCGGGACCAGGGTGCAGG + Intronic
1035153745 7:156895479-156895501 AGTGACCTGGACCAGGGTGGAGG + Intergenic
1035622651 8:1045641-1045663 GGTTACCAGGACCTGGGTGGGGG - Intergenic
1035666412 8:1383668-1383690 GTCCACCTGGCCCAGGGCTGAGG + Intergenic
1036369968 8:8154429-8154451 GGCCAGATGGTCCAGGTTGGGGG - Intergenic
1036880924 8:12511201-12511223 GGCCAGATGGTCCAGGTTGGGGG + Intergenic
1037630269 8:20649441-20649463 GGTCCTCTGGACCAGGGCGGTGG + Intergenic
1037760914 8:21740965-21740987 GGCCACTCAGCCCAGGGTGGTGG - Intronic
1040569745 8:48597140-48597162 AGCCACCTGGCCAAGCGTGGTGG - Intergenic
1042387915 8:68199149-68199171 TGCCACCTGGAACTGGGTGCTGG - Intronic
1042810693 8:72822536-72822558 TGGCACCTGGACTAGGGTGGTGG - Intronic
1044792776 8:95864871-95864893 GGGCATCTTCACCAGGGTGGAGG + Intergenic
1047190964 8:122678952-122678974 GGCAGCCTGTTCCAGGGTGGAGG - Intergenic
1049033682 8:140057954-140057976 GACCACCTGCACCACGCTGGGGG + Intronic
1049226197 8:141451689-141451711 GGTGTCCTGGACTAGGGTGGTGG + Intergenic
1049360023 8:142208032-142208054 GGCCACCTGCTTCAGGGTGATGG - Intergenic
1049586584 8:143435265-143435287 GGGCAGCAGGAGCAGGGTGGGGG - Intergenic
1049611671 8:143558783-143558805 GGGCACCTGGGCCACTGTGGAGG - Intronic
1049738603 8:144223153-144223175 GGCTACCTGGAGCAGCCTGGAGG + Exonic
1050259793 9:3829104-3829126 TGGCTCCTGCACCAGGGTGGTGG + Intronic
1052102663 9:24468909-24468931 GGGCACCTGGAACAGTGTGAGGG - Intergenic
1053297257 9:36923765-36923787 GGCCAACTGGAGCTGGGTGAGGG - Intronic
1053360416 9:37482704-37482726 GGCCACCTGGCCAGGTGTGGTGG + Intergenic
1056006247 9:82274616-82274638 ACCCATCTGGAGCAGGGTGGTGG - Intergenic
1057195522 9:93114053-93114075 GGCCCCATGGCTCAGGGTGGAGG - Intergenic
1057300749 9:93880236-93880258 GGCGCCGTGGAGCAGGGTGGGGG - Intergenic
1058997712 9:110315982-110316004 AACCACCTGGACCCGGGAGGCGG - Intronic
1059657706 9:116371059-116371081 TGCCACCTGAACCAGGCAGGTGG + Intronic
1060229881 9:121818712-121818734 GGCCAGCAAGACAAGGGTGGTGG + Intergenic
1060660073 9:125400039-125400061 GACCACCTGGAGCACGCTGGAGG - Intergenic
1060943347 9:127555995-127556017 GGCCACCAGGACCAGGGCCCAGG + Intronic
1062459024 9:136655169-136655191 TGTCACCTGGGCCAGGATGGTGG + Intergenic
1062478475 9:136741036-136741058 GGACACCTGCACCTGGGTGGGGG - Intronic
1062480857 9:136750432-136750454 GGGGAGCTGGAACAGGGTGGGGG + Intergenic
1062554913 9:137109599-137109621 GGTCACCTGGTTCAGGGTCGGGG - Intergenic
1062571231 9:137186290-137186312 GGTCACCTGGTGCAGGGTGGTGG + Exonic
1203787126 EBV:134289-134311 GGCCGCCTCGGCCAGGTTGGCGG - Intergenic
1203363493 Un_KI270442v1:237848-237870 GGCCAGCTGGAGGAGGGCGGCGG + Intergenic
1185456061 X:311425-311447 GGCCACGTCTTCCAGGGTGGCGG + Exonic
1185800238 X:3004080-3004102 AGCCACATGGAGCGGGGTGGGGG - Intergenic
1189425477 X:40896544-40896566 GGCCAGCTGGAGCATGGAGGTGG + Intergenic
1191890309 X:65932580-65932602 GCACACCTGGACAAGGGAGGGGG + Intergenic
1192182397 X:68924378-68924400 TGAGACCTGGACCACGGTGGAGG - Intergenic
1192248094 X:69389483-69389505 AGCCCCATGGACCAGGCTGGAGG - Intergenic
1192420760 X:71028155-71028177 AGTGACCTGGACCAGGGTAGTGG + Intergenic
1192575291 X:72238790-72238812 ACCGACCTGGCCCAGGGTGGAGG - Intronic
1197702847 X:129612522-129612544 GGCCTCTTGGACCAGAATGGAGG - Intergenic
1200094248 X:153649870-153649892 GGCCATCTGGCCCAGGGGGCAGG + Intronic
1200169343 X:154060988-154061010 GGACACCTGGACCAGGGTGGGGG + Intronic
1200274139 X:154716025-154716047 GGCCACCTGGAGGATGGTGCAGG - Exonic