ID: 946618820

View in Genome Browser
Species Human (GRCh38)
Location 2:221539085-221539107
Sequence CTGTGTCAGGACCTTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946618820_946618824 -6 Left 946618820 2:221539085-221539107 CCAAGTTCAAGGTCCTGACACAG 0: 1
1: 0
2: 1
3: 24
4: 288
Right 946618824 2:221539102-221539124 ACACAGGGCCATGACAATCCAGG 0: 1
1: 0
2: 0
3: 9
4: 169
946618820_946618827 15 Left 946618820 2:221539085-221539107 CCAAGTTCAAGGTCCTGACACAG 0: 1
1: 0
2: 1
3: 24
4: 288
Right 946618827 2:221539123-221539145 GGAGTAGTAGCAGCAGTAGCAGG 0: 1
1: 0
2: 5
3: 57
4: 460
946618820_946618828 21 Left 946618820 2:221539085-221539107 CCAAGTTCAAGGTCCTGACACAG 0: 1
1: 0
2: 1
3: 24
4: 288
Right 946618828 2:221539129-221539151 GTAGCAGCAGTAGCAGGAGTAGG 0: 1
1: 0
2: 4
3: 117
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946618820 Original CRISPR CTGTGTCAGGACCTTGAACT TGG (reversed) Intronic
900855120 1:5175191-5175213 ATCTGCCAGGACCTTGATCTTGG + Intergenic
901611999 1:10506038-10506060 CTGTGTCAAGAGCTTGCATTTGG + Intronic
901639973 1:10688195-10688217 CTGTGCCAGGACCCAGCACTCGG - Intronic
901681163 1:10913614-10913636 CTGGGTCAGGAATTTGAACAGGG + Intergenic
904442517 1:30540882-30540904 CTGTGTGAGGACCTTCAGCTAGG - Intergenic
904509934 1:30996254-30996276 TTGTACCAGGAACTTGAACTTGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905450973 1:38055952-38055974 AAATGTCAGGACCTTGACCTGGG + Intergenic
905462720 1:38132091-38132113 CTGGGTCAGGAGGTGGAACTGGG + Intergenic
905509796 1:38510096-38510118 ATGTGTCAGGAGCTGGAAATTGG + Intergenic
909763182 1:79320220-79320242 ATCTGTCAGCACCTTGATCTTGG - Intergenic
909765342 1:79349094-79349116 ATCTGTCAGCACCTTGATCTTGG - Intergenic
910552043 1:88486320-88486342 CTGTGTCAAGACCTGGTACCAGG - Intergenic
911639057 1:100267517-100267539 CCTTGTCAGGACCTTGATCTTGG - Exonic
912499391 1:110112117-110112139 CTGTGCCAGCACCTGGACCTGGG - Intergenic
913464813 1:119129267-119129289 ATGTGTCAGCACCTTGATCTTGG + Intronic
915067031 1:153233193-153233215 CTTTCTTGGGACCTTGAACTTGG - Intergenic
917255992 1:173116761-173116783 ATGTGCCAGTACCTTGATCTTGG + Intergenic
917709116 1:177666403-177666425 CTGTTTCAGGGCCCTGATCTGGG + Intergenic
918095994 1:181334695-181334717 CTGTGACAGTAGCTTGAACCAGG - Intergenic
918636334 1:186779231-186779253 ATCTGTCAGTACCTTGATCTTGG - Intergenic
920606836 1:207397015-207397037 CTCTGCCAGCACCTTGATCTTGG + Intergenic
921551186 1:216537308-216537330 ATGTGCCAGCACCTTGATCTTGG + Intronic
923350721 1:233102938-233102960 ATGCTTCAGGACCTTGGACTGGG - Intronic
1063932277 10:11041037-11041059 ATGTGTCAGCACCTTGATGTTGG - Intronic
1064199266 10:13270955-13270977 CTGTGCCAACACCTTGATCTTGG + Intergenic
1064564434 10:16625566-16625588 CTGTTTCAGGGCCTTGAAGCAGG - Intronic
1065637006 10:27743553-27743575 CAGGTTCAGGGCCTTGAACTTGG + Intronic
1068098847 10:52526778-52526800 GTGTCTGAGGCCCTTGAACTGGG + Intergenic
1068514168 10:58005388-58005410 CTGTGTCAGGCTCTGGGACTTGG - Intergenic
1068765811 10:60762460-60762482 CTGTCTCAAGACAGTGAACTGGG - Intergenic
1068926364 10:62543696-62543718 ATGTGTCATGACTTTGAAGTTGG + Intronic
1069361839 10:67652046-67652068 ATGGGCCAGTACCTTGAACTAGG - Intronic
1069515099 10:69070986-69071008 CTGTGTGAAGACCTGGAACGTGG - Intergenic
1072063679 10:91843252-91843274 CTCTGCCAACACCTTGAACTTGG - Intronic
1074973667 10:118564299-118564321 GTGTGTCTGGACCCTTAACTGGG - Intergenic
1075219480 10:120572240-120572262 CTGTCTCAGGAACTTGTATTTGG - Intronic
1075652907 10:124141312-124141334 CTCTGCCAGCACCTTGATCTTGG - Intergenic
1077042666 11:531442-531464 CTGTGGCCAGACCTAGAACTTGG + Intergenic
1077141248 11:1025865-1025887 CTCTGTCAGGATCTTGAAGGTGG + Exonic
1078316860 11:10301218-10301240 CTGTGTCAGGGTTTTAAACTTGG + Intergenic
1082969308 11:59002821-59002843 CTGTGTCAGCTTTTTGAACTGGG - Intronic
1083686795 11:64381360-64381382 CTGTGACAGGACCCTGAGCAGGG - Intergenic
1084609443 11:70192967-70192989 CTGAGTGAAGACTTTGAACTTGG + Intergenic
1085402891 11:76245067-76245089 CTCTGTCTGCACCTTGATCTTGG + Intergenic
1085664650 11:78403076-78403098 ATGTGTCAGTGCCTTGATCTTGG + Intronic
1085831464 11:79905791-79905813 ATCTGCCAGGACCTTGACCTTGG - Intergenic
1086569285 11:88263801-88263823 ATGTGTCAGGACCTTCCAGTTGG - Intergenic
1087908862 11:103729754-103729776 CCCTGTCAGAACCTTGATCTTGG - Intergenic
1088234542 11:107708378-107708400 CTGTGCCAACACCTTGATCTGGG + Intronic
1088394678 11:109353403-109353425 CTCTGTCAGTTCCTTGAACATGG + Intergenic
1088448015 11:109953037-109953059 ATCTGCCAGCACCTTGAACTTGG - Intergenic
1089082115 11:115785285-115785307 CTGTGTCAGGGCCAGGAAGTGGG + Intergenic
1089374890 11:117987072-117987094 CTGGGTTAGGAGCCTGAACTGGG - Intronic
1090105142 11:123845714-123845736 CTGTCTTAGGACCTTGAATCTGG - Intergenic
1090736481 11:129615872-129615894 CTGTGGCAAGAACTTGGACTCGG - Intergenic
1090736803 11:129617833-129617855 CTGTGGCAGAAACTTGGACTCGG - Intergenic
1092819082 12:12336297-12336319 CTGCCTGAGGACCTTGGACTTGG + Intronic
1093030100 12:14280393-14280415 CTGAGGCAGGAGCTTGAACCTGG + Intergenic
1094056390 12:26273379-26273401 CTCTGCCAGCACCTTGATCTTGG - Intronic
1096367841 12:51043805-51043827 CTGTGTCATGTCCTTGACCTTGG - Intergenic
1097464174 12:59902028-59902050 AGGTGTCAGCACCTTGATCTTGG - Intergenic
1098233033 12:68392098-68392120 CTCTGCCAGCACCTTGATCTCGG - Intergenic
1100246133 12:92758783-92758805 CAGTCTCAGGACTTTGCACTTGG - Intronic
1100610106 12:96184777-96184799 GTCTGTCAGCACCTTGATCTTGG + Intergenic
1101541619 12:105670716-105670738 CAGTGTCAAGACCTTGTATTAGG - Intergenic
1101889627 12:108701543-108701565 CTGTTTCTGGATCTTGAATTAGG - Intronic
1102100340 12:110273470-110273492 TTGTGTCAGGAGCTTGGAATTGG + Intergenic
1102864591 12:116364052-116364074 CAGTGGCATGACCTTGATCTTGG + Intergenic
1103352027 12:120290724-120290746 GTCTGTGAGGTCCTTGAACTGGG + Intergenic
1103897735 12:124285022-124285044 CTCTGCCAGCACCTTGATCTTGG - Intronic
1106499449 13:30313304-30313326 CTGTTTTAGGACCTTGCATTTGG + Intergenic
1108034603 13:46275870-46275892 ATGTTTCAGGACATTGACCTAGG - Intronic
1108136674 13:47370858-47370880 CTGCTTCAGGACATTGAGCTGGG + Intergenic
1108267598 13:48728351-48728373 CCCTGTCAGCACCTTGATCTTGG - Intergenic
1108347491 13:49560662-49560684 CTGTGTCAGGAATTTGGACAGGG + Intronic
1108742984 13:53357918-53357940 CTGTTTTAGGAGCTTGGACTTGG + Intergenic
1109283180 13:60380496-60380518 CAGTTTCAGGACCTTTATCTCGG + Intergenic
1110493439 13:76136516-76136538 CTGGGTCAGGAATTTGAACAGGG - Intergenic
1111211062 13:85080975-85080997 CTATGTCAGGAGTCTGAACTAGG - Intergenic
1112686837 13:101838697-101838719 CTGTAATATGACCTTGAACTAGG + Intronic
1113287744 13:108871644-108871666 CTGTTTCTGAACCCTGAACTTGG + Intronic
1115144238 14:30207836-30207858 CTGTTTCAGGCCCTGGAAATGGG + Intergenic
1116543774 14:46136070-46136092 ATCTGTCAGCACCTTGATCTTGG + Intergenic
1116900842 14:50361495-50361517 CAGTGCCAGCACCTTGATCTTGG - Intronic
1116917702 14:50541385-50541407 ATGTGTCAGGTTCCTGAACTGGG - Intronic
1117627398 14:57653876-57653898 CTGTATCAATACCTTGATCTTGG - Intronic
1118603505 14:67486871-67486893 CTGTGACAGGACCTTGGATGGGG + Intronic
1120840052 14:89077721-89077743 CCGTGGCAGGCCCTTGGACTTGG - Intergenic
1120885016 14:89445283-89445305 CAGTGTCATGACCCTTAACTAGG + Intronic
1121375961 14:93411013-93411035 AGGAGTCAAGACCTTGAACTGGG - Intronic
1122302836 14:100740856-100740878 CTGTGTCAGGGTCCTGGACTGGG - Intergenic
1126107314 15:45155154-45155176 GTGTGCCAGGCCCTTGCACTAGG + Intronic
1127845619 15:62868042-62868064 CTCTGTCAACACCTTGATCTTGG + Intergenic
1129101639 15:73270223-73270245 ATGTGTCAGTACCTTGTACTTGG - Exonic
1130833800 15:87629911-87629933 CTTTGGCAGTACCTTGATCTTGG - Intergenic
1131153975 15:90063557-90063579 CTGTGTCAGGAGCCTGTGCTTGG - Intronic
1131545865 15:93314970-93314992 CTGTGTCAACACCTTGATCTTGG - Intergenic
1131939646 15:97546776-97546798 CTGTGTCAGGAACTTAGCCTTGG + Intergenic
1132300018 15:100769384-100769406 CTGTGCCGGGACCTTGCTCTAGG + Intergenic
1132375289 15:101324713-101324735 CTGAGTAAGGACTTTGAACAGGG - Intronic
1133278944 16:4654318-4654340 CTGTGTCAGGAACTGGGGCTGGG + Intronic
1133279178 16:4655496-4655518 CTCTGTCAGGACCTGGTACGAGG + Intronic
1133604189 16:7369962-7369984 ATGTGTCAGAGCCTTGAGCTAGG + Intronic
1134180209 16:12041769-12041791 CTGTGTTAGGATCTGGAAATTGG - Intronic
1134632217 16:15765081-15765103 GTGTATCAGGACCTTGGAATAGG - Intronic
1135345946 16:21688597-21688619 GTCTGTCAGCACCTTGATCTTGG - Intronic
1136524183 16:30817581-30817603 CTGAGGCAGAAGCTTGAACTTGG - Intergenic
1137382385 16:48011441-48011463 ATGTGTCAGAACCTTGATCTTGG - Intergenic
1137382835 16:48014546-48014568 CTGTGTCAGCACCTTGGAGAGGG + Intergenic
1137940628 16:52680287-52680309 ATCTGCCAGCACCTTGAACTTGG - Intergenic
1138292158 16:55856892-55856914 CGGTATCAGCACCTTGACCTCGG + Intronic
1138535917 16:57660323-57660345 CTGTGTCAGGACTTTGTGTTTGG + Intronic
1138932624 16:61678935-61678957 CAATGTCATGACCTGGAACTTGG + Intronic
1140786693 16:78349081-78349103 CTGTGCCGGAACCTTGACCTTGG - Intronic
1140873558 16:79129025-79129047 CTGTGTCAGGACAATGAACTTGG - Intronic
1141159291 16:81618397-81618419 CCATCTCAAGACCTTGAACTTGG + Intronic
1141523065 16:84594294-84594316 CTGTGTCAGGAGCTTTAGGTTGG - Intronic
1143326932 17:6105141-6105163 CTGAGTCATGACCTTGCTCTAGG + Intronic
1143914769 17:10282083-10282105 CTCTGTCAGCATCTTGATCTTGG - Intergenic
1143964829 17:10749727-10749749 CAGTGCCAGGACCTTGGAGTTGG + Intergenic
1144869551 17:18360730-18360752 CTTTGTCTGGCCTTTGAACTTGG - Intronic
1146964196 17:37010917-37010939 ATGTGTCAGGACATTTAACAGGG - Intronic
1147131252 17:38410645-38410667 CTGTGCCAGGCCCTGGAAGTGGG - Intergenic
1147247360 17:39131227-39131249 CTGTGTCAGGACCAAGATCGAGG + Intronic
1147993443 17:44349057-44349079 CTGGGCCAGGACCTTGGCCTGGG + Intronic
1150470148 17:65430482-65430504 CTCTGTTAGGACCCAGAACTGGG - Intergenic
1151107017 17:71626722-71626744 CTCTGCCAGCACCTTGACCTTGG + Intergenic
1153464342 18:5372279-5372301 ATGTGCCAGCACCTTGATCTTGG + Intergenic
1153767055 18:8384939-8384961 CTGTCACAGGACCTTGCAGTGGG + Intronic
1153874655 18:9358312-9358334 CTCTGTTAGGAATTTGAACTAGG - Intronic
1154121329 18:11654858-11654880 CTGTGACCGGACCCTGAAGTCGG - Intergenic
1155605978 18:27606395-27606417 ATCTGTCAGCACCTTGATCTTGG - Intergenic
1156291642 18:35753011-35753033 CTGTGACAGGACATTGTCCTGGG - Intergenic
1157846993 18:51013290-51013312 CTGAGTTAGGATCTTGAACTTGG - Intronic
1158160758 18:54480682-54480704 CAATGGCAGGACCTTGAAATTGG + Intergenic
1158480969 18:57821469-57821491 CTGAGGCAGGAGCTTGAACCTGG + Intergenic
1158528276 18:58234785-58234807 CTGAGGCAAGATCTTGAACTTGG - Intronic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1160050931 18:75432462-75432484 TTGTTTTAAGACCTTGAACTGGG + Intergenic
1160371328 18:78374063-78374085 CTGTGTCAGAGCATTGAGCTCGG + Intergenic
1162182693 19:8881266-8881288 CTGCTTCAGGACCTTGTACATGG - Intronic
1162643289 19:12030150-12030172 ATCTGTCAGCACCTTGAACATGG + Intronic
1163237248 19:16037031-16037053 CTGTGGTATGACCTTGAACAGGG - Intergenic
1167880826 19:52456023-52456045 CTGTCTCAGGACCTTCACCTGGG + Intronic
1167906094 19:52661936-52661958 CTGTCTCAGGGCCTTCACCTGGG - Intronic
925799943 2:7588933-7588955 TTGTGTCTTAACCTTGAACTTGG - Intergenic
926697747 2:15782520-15782542 CTCTGTCAGGAGCTTGAAATAGG - Intergenic
926835554 2:17015692-17015714 CTGTTTCAGGAGTTTGAACTTGG - Intergenic
926936604 2:18092156-18092178 ATCTGCCAGCACCTTGAACTTGG - Intronic
928035541 2:27819178-27819200 CTTTGCCAGTACCTTGATCTTGG - Intronic
928206657 2:29289447-29289469 CTGAGTCAGTTCTTTGAACTGGG - Intronic
928221865 2:29409922-29409944 CTCTGCTTGGACCTTGAACTGGG + Intronic
928265834 2:29810985-29811007 CTCTGACAGCACCTTGATCTTGG + Intronic
930235539 2:48885479-48885501 CGATGTCAGTACATTGAACTTGG + Intergenic
933126657 2:78617111-78617133 CAGTGTCAGAACTTTGTACTTGG - Intergenic
936235635 2:110740365-110740387 CTGTGTCAGGCCCTGGAGATGGG + Intronic
936508614 2:113128028-113128050 CTCTGTCAGCACATTCAACTAGG - Intronic
937466490 2:122137464-122137486 CTCTGCCAGCACCTTGATCTTGG + Intergenic
937656987 2:124387842-124387864 CTGTGGAAGGAGCTTGAAATTGG - Intronic
937695654 2:124805748-124805770 CACTGCCAGTACCTTGAACTTGG - Intronic
938096791 2:128469450-128469472 TTGTGTGGGGACCTGGAACTAGG - Intergenic
938875112 2:135524178-135524200 CTGAGGCAGGAGCTTGAACCCGG - Intronic
938962195 2:136353870-136353892 ATGTGCCAGGGCCTTGATCTTGG + Intergenic
940291453 2:152081349-152081371 CTCTGTCAGTATCTTGATCTTGG - Intronic
940511026 2:154615112-154615134 CAGTCTCAGGAATTTGAACTGGG + Intergenic
941033848 2:160544461-160544483 CAATGTCAGCACCTTGATCTTGG + Intergenic
943551888 2:189351343-189351365 CTTTGTCAAGACCTGGAATTTGG + Intergenic
943576504 2:189637309-189637331 CTGTGTCAGGCACTGGAACAGGG + Intergenic
945161045 2:206890814-206890836 TTGTGCCAGAACCTTGACCTTGG + Intergenic
945320214 2:208412598-208412620 CTGTGTGAGGACACTGTACTGGG + Intronic
946255012 2:218435767-218435789 CTGTGTCAGGACCTAAAAGCAGG - Intronic
946618820 2:221539085-221539107 CTGTGTCAGGACCTTGAACTTGG - Intronic
1169603880 20:7293464-7293486 ATGTGACAGCACCTTGATCTTGG + Intergenic
1170209581 20:13835396-13835418 CTTTGTCAGGAACCAGAACTGGG - Intergenic
1171193544 20:23179257-23179279 CTGTCTCAGCTCTTTGAACTTGG + Intergenic
1172764460 20:37343962-37343984 CTGAGCCAGGCCCTTGAAGTCGG + Intergenic
1174533631 20:51234034-51234056 CCCTGCCAGCACCTTGAACTTGG - Intergenic
1175546325 20:59780402-59780424 ACGTGTCAGAACCTTGATCTTGG - Intronic
1175733942 20:61372475-61372497 CTGTGTCAGGCCCCTGAGGTGGG - Intronic
1176947287 21:14998203-14998225 GTCTGTCAGCACCCTGAACTAGG + Intronic
1178247683 21:30969587-30969609 ATCTGTCAGCACCTTGATCTTGG + Intergenic
1181460294 22:23082308-23082330 CTGAGACAGGAGCTTGAACCTGG - Intronic
1182951131 22:34376960-34376982 ATCTGTCAGCACCTTGACCTTGG - Intergenic
1183077608 22:35436732-35436754 CTGGGTCAGGACCCTGTCCTAGG + Intergenic
1184661606 22:45967965-45967987 CTGGGTGAGGAGCTGGAACTGGG + Intronic
949932449 3:9089446-9089468 GTGTGTCTGCATCTTGAACTAGG - Intronic
950021358 3:9789893-9789915 CTGGGTCGAGACCATGAACTTGG - Exonic
950097723 3:10339529-10339551 CTGTGACAGGGTCTGGAACTTGG + Intronic
950674728 3:14547881-14547903 CAGTGACTGGACTTTGAACTTGG - Intergenic
950798565 3:15531244-15531266 CTGTGTCTGGTCCTGGAGCTGGG - Intergenic
951347473 3:21563272-21563294 ATTTGTCAGCACCTTGATCTTGG + Intronic
952068806 3:29607337-29607359 ATCTGTCAGCACCTTGATCTTGG - Intronic
952814833 3:37438254-37438276 ATCTGTCAGCACCTTGATCTTGG - Intergenic
953900916 3:46843422-46843444 CAGGTTCAGGACCTTGAAATGGG + Intergenic
956528904 3:70195073-70195095 CAGTGTCAGGAACTCTAACTTGG - Intergenic
957170745 3:76733862-76733884 CTCTGCCAGCACCTTGATCTTGG - Intronic
959390407 3:105765449-105765471 ATTTGTCAGCACCTTGATCTTGG + Intronic
960826542 3:121791990-121792012 CTGAGGCAGGAGCTTGAACCTGG + Intronic
961567306 3:127772931-127772953 ATCTGTCAGCACCTTGACCTTGG + Intronic
964033714 3:152169829-152169851 GTCTGCCAGCACCTTGAACTTGG - Intergenic
964436130 3:156655784-156655806 TTATGTCAGGACCTTGAGCGTGG - Intergenic
964658188 3:159091312-159091334 CCGTGTCAGCACCCTGATCTTGG - Intronic
964664228 3:159154522-159154544 CTATGTGAGGCCTTTGAACTTGG + Intronic
965956224 3:174373223-174373245 GTGTTTCAGGACGTTGATCTGGG + Intergenic
969177253 4:5408041-5408063 ATCTGTCAGGGCCTTGATCTTGG + Intronic
969216411 4:5726076-5726098 CTGTGTCAGCACCTCAAATTAGG + Intronic
969525101 4:7700282-7700304 CTGTGGCAGGGCCTGAAACTGGG + Intronic
969726167 4:8919746-8919768 CTGTGTGAGCACCTTGACCTGGG + Intergenic
970343061 4:15127062-15127084 CTGTGCCAGTGCCTTGATCTTGG + Intergenic
973766338 4:54166661-54166683 ATGTGTCTGAGCCTTGAACTTGG - Intronic
974596588 4:64020718-64020740 CTGTGTAGGGACAATGAACTAGG - Intergenic
975491445 4:74993449-74993471 GTGGGTCAGGAATTTGAACTGGG - Intronic
975689974 4:76953219-76953241 ATGTGTCAGGAACTTGTTCTAGG + Intronic
977468381 4:97410698-97410720 CTCTGTCAGCAACTTGATCTGGG + Intronic
977588276 4:98799622-98799644 CTGTCTCAGGGCCTTGAGTTTGG - Intergenic
977700955 4:100022249-100022271 CAGTGCCAGTACCTTGATCTTGG - Intergenic
980334045 4:131445459-131445481 CTATGTCAGCACCTTGATCTTGG + Intergenic
981016705 4:139981127-139981149 CCTTGCCAGGACCTTGATCTTGG - Intronic
982248879 4:153384104-153384126 CAGTGTCAGGACAATGAACTTGG - Intronic
982912742 4:161165346-161165368 ATCTGCCAGCACCTTGAACTTGG - Intergenic
982954114 4:161740874-161740896 ATATGTCAGCACCTTGATCTTGG - Intronic
983267493 4:165522761-165522783 ATCTGCCAGGACCTTGATCTTGG + Intergenic
984669485 4:182466262-182466284 CTGTGTCAACACCTTGATTTTGG - Intronic
986128398 5:4904907-4904929 CTGTGTCATCACCTGGACCTGGG + Intergenic
986484972 5:8226904-8226926 CCCTGTCAGCACCTTGATCTTGG + Intergenic
987729426 5:21749275-21749297 CTCTGTCAACACCTTGATCTTGG + Intergenic
992371429 5:76148144-76148166 CTCTTCCAGAACCTTGAACTTGG - Intronic
993443952 5:87989343-87989365 CCCTGTCAGGACCCTGACCTTGG - Intergenic
994599598 5:101886399-101886421 CTGTGCCAGTACTTTGATCTTGG - Intergenic
996428268 5:123339342-123339364 GTCTGTCAGCACCTTGATCTTGG - Intergenic
1001072823 5:168601503-168601525 CTCTGTCAGCACCTTGATCCTGG - Intergenic
1002204010 5:177550380-177550402 CTGTGCCAGGACCTTTATTTGGG - Intronic
1002460528 5:179371142-179371164 CTCTGCCAACACCTTGAACTCGG - Intergenic
1004621336 6:17333239-17333261 CTGAGGCAGGAGCTTGAACCCGG - Intergenic
1006065992 6:31463048-31463070 CTGTGTCAGGTCCTTTTACCTGG + Intergenic
1007319971 6:41021008-41021030 ATCTGTCAGAACCTTGATCTTGG - Intergenic
1008239538 6:49092465-49092487 ATGTTTCAGGACATTGATCTAGG - Intergenic
1008548350 6:52603512-52603534 CCTTGTCAGGAGCTTGAGCTAGG + Intergenic
1008718471 6:54318817-54318839 CTGTGTCAACACCTTGACCGGGG + Intronic
1008780867 6:55103196-55103218 ATCTGTCAGCACCTTGATCTTGG - Intergenic
1008804679 6:55412957-55412979 GTTTGTCAGGACCTTGAGGTGGG + Intergenic
1008981045 6:57484606-57484628 TTGTTTCAGGGCCTTAAACTTGG + Intronic
1009711595 6:67329233-67329255 CTCTGTGAAGCCCTTGAACTTGG - Intergenic
1010057088 6:71579143-71579165 CTGAGTCAGAAACTGGAACTGGG + Intergenic
1011240986 6:85271163-85271185 CCGTTTCAGGCCCTTGAACTGGG - Intergenic
1013763660 6:113549306-113549328 ATGTGTCATGACATTGATCTGGG + Intergenic
1014275863 6:119387945-119387967 CTATGCCAGAACCTTGAGCTTGG - Intergenic
1015640444 6:135326360-135326382 CTGTGCTAGCACCTTGATCTTGG + Intronic
1016599416 6:145841205-145841227 ATGTGTCAGCACCTTGATCTTGG - Intergenic
1017209044 6:151834831-151834853 CTGTGGCAGCACCTGGAACTTGG + Intronic
1018021835 6:159768367-159768389 CTGGCTGAGGACCTAGAACTGGG + Intronic
1018035108 6:159875089-159875111 CTCTGCCAGCACCTTGATCTTGG + Intergenic
1018705150 6:166458729-166458751 CCCTGTCAGTACCTTGAACTTGG + Intronic
1021315654 7:19144795-19144817 GTGTGTCAGGACCGGGCACTGGG - Exonic
1022040700 7:26578903-26578925 CTGTGACAAGACCTTGCACCTGG + Intergenic
1022945959 7:35283912-35283934 CCCTGTCAACACCTTGAACTTGG + Intergenic
1023870009 7:44258029-44258051 CTGTTCCAGGACCCTGACCTGGG - Intronic
1024378858 7:48671103-48671125 CCTTGCCAGCACCTTGAACTTGG - Intergenic
1025717110 7:63969656-63969678 CTGTGGCAGGAGCTTGAACCTGG - Intergenic
1026299381 7:69083867-69083889 CCCTGTCAGCACCTTGATCTTGG - Intergenic
1026309527 7:69171737-69171759 CTGTGGCAGGACCTTAAAGTTGG + Intergenic
1026315852 7:69226609-69226631 ATCTGACAGCACCTTGAACTTGG - Intergenic
1028073989 7:86488012-86488034 CTTTGTGAGGAACTTGAACATGG + Intergenic
1031843921 7:126781311-126781333 CAGTGTTGGAACCTTGAACTTGG - Intronic
1032267436 7:130379431-130379453 CTGTGTCAGGACCCCGACCTTGG - Intergenic
1032382459 7:131499084-131499106 CTGTGTGAGTTCCTTGTACTTGG + Intergenic
1032688497 7:134259268-134259290 CTGAGTAAAGACCTTGAACAGGG + Intronic
1033142515 7:138840253-138840275 CTGTGTCAGGTGCTGGATCTGGG + Exonic
1035398663 7:158551143-158551165 CTGTGCCAGCACCCTGATCTTGG - Intronic
1036762300 8:11517793-11517815 CTGTGACAGGACCAAGAGCTTGG - Intronic
1038340108 8:26679068-26679090 CCGTGCCAGCACCTTGATCTTGG - Intergenic
1039584551 8:38695163-38695185 CTGTTCCAGGCCCTTGAATTTGG + Intergenic
1040575852 8:48650492-48650514 CTGTGTCATGACCTTGAAGAAGG - Intergenic
1040596436 8:48841898-48841920 CAGTGTCAGGATCTGGAATTTGG + Intergenic
1042970958 8:74408583-74408605 ATTTGTCAGTACCTTGATCTTGG + Intronic
1043487314 8:80710729-80710751 ATCTGCCAGGACCTTGATCTTGG + Intronic
1043550078 8:81361474-81361496 ATGTGCCAGCACCTTGATCTTGG - Intergenic
1044021500 8:87111146-87111168 CTGTTTCAGGGACTTGCACTTGG + Intronic
1047777962 8:128089246-128089268 ATCTGTCAGCACCTTGATCTTGG - Intergenic
1048176641 8:132158471-132158493 CTGTGTCAGGGACTTCAGCTAGG + Intronic
1048485391 8:134843242-134843264 ATATGTCAGCACCTTGATCTCGG + Intergenic
1048493026 8:134912231-134912253 CTCTGTCAGTACCTTGACCTTGG + Intergenic
1049984021 9:931565-931587 CTCTGACAGCACCTTGATCTTGG - Intronic
1050298867 9:4236103-4236125 CTGTGTGAGAACAGTGAACTTGG - Intronic
1054733654 9:68728253-68728275 ATCTGTCAGCACCTTGATCTTGG - Intronic
1055096635 9:72421175-72421197 ATGTGTAAGCACCTTGATCTTGG - Intergenic
1055171317 9:73262040-73262062 CTGTGTTAGGATCTTGAAGCCGG + Intergenic
1055483773 9:76736518-76736540 GTATGTCAGGATCTTGATCTTGG - Intronic
1055842539 9:80522510-80522532 CCTTGCCAGGACCTTGATCTTGG + Intergenic
1056250772 9:84745826-84745848 CTGTGTCAAGACCTACAACCTGG - Intronic
1057050055 9:91916685-91916707 CAGTGTCAGGACCTGGAAAAGGG - Intronic
1057759758 9:97862747-97862769 CTGTGGAAGGGCCCTGAACTAGG - Intergenic
1057818310 9:98311891-98311913 CTCTGGCAGGAACTTGAATTGGG + Intronic
1058669380 9:107347783-107347805 ATGTATCAGGCACTTGAACTTGG - Intergenic
1059213225 9:112534143-112534165 CTGTGTCATGACATAGAGCTTGG + Intronic
1062401199 9:136373459-136373481 CAGTGCCAGGATCCTGAACTAGG + Intronic
1062427182 9:136511422-136511444 CTGTGCCAGGACCCTGACCCAGG + Intronic
1062514383 9:136925240-136925262 CTCTGTCAGGACTGTGAACCTGG - Intronic
1186922731 X:14300253-14300275 CTGTTTTAGGACCTTTAACCTGG + Intergenic
1188158360 X:26769872-26769894 CTCTGTCACCACCTTGCACTGGG - Intergenic
1194450136 X:94035128-94035150 CTCTGCCAGTACCTTGAACTTGG - Intergenic
1195293656 X:103454198-103454220 CAGTGGAAGGACCTTGAAGTTGG + Intergenic
1195655769 X:107330105-107330127 CTCTGCCAGCACCTTGATCTTGG + Intergenic
1195693326 X:107647338-107647360 CTTTGTCTGCACCTTGATCTTGG + Intronic
1195823034 X:108968189-108968211 CTGTGTCAGGTCACTGTACTGGG - Intergenic
1195914596 X:109923808-109923830 CTGTGTCATCACCATGCACTAGG - Intergenic
1196315100 X:114213191-114213213 CTGTGTTGGCACCTTGATCTTGG - Intergenic
1196580460 X:117373302-117373324 ATGTGCCAGCACCTTTAACTTGG + Intergenic
1197234762 X:124048526-124048548 CTGAGGCAGGAGCTTGAACCTGG - Intronic
1197408309 X:126083456-126083478 ATGTTTCAGGACATTGGACTGGG - Intergenic
1198512806 X:137371259-137371281 CTCTGTCAACACCTTGATCTTGG - Intergenic
1199582866 X:149377824-149377846 CTGTCTCTGGACCTTCGACTGGG + Intergenic
1200950599 Y:8895109-8895131 CTGTGTCACTCCCTTGAACCAGG - Intergenic