ID: 946622432

View in Genome Browser
Species Human (GRCh38)
Location 2:221573549-221573571
Sequence GAGGAGGGGCGGCCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 916
Summary {0: 1, 1: 0, 2: 15, 3: 84, 4: 816}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946622432_946622448 13 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622448 2:221573585-221573607 AGCAGGGCCGAGTTTTCCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 205
946622432_946622450 20 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622450 2:221573592-221573614 CCGAGTTTTCCTGGGGAGCCTGG 0: 1
1: 0
2: 2
3: 12
4: 173
946622432_946622441 -4 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622441 2:221573568-221573590 CCTCTGACTCCCTCCAGAGCAGG 0: 1
1: 1
2: 2
3: 26
4: 317
946622432_946622446 11 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622446 2:221573583-221573605 AGAGCAGGGCCGAGTTTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 166
946622432_946622454 30 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622454 2:221573602-221573624 CTGGGGAGCCTGGGTCCCGGCGG 0: 1
1: 1
2: 1
3: 55
4: 387
946622432_946622442 -3 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622442 2:221573569-221573591 CTCTGACTCCCTCCAGAGCAGGG 0: 1
1: 0
2: 3
3: 34
4: 312
946622432_946622451 21 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622451 2:221573593-221573615 CGAGTTTTCCTGGGGAGCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 153
946622432_946622447 12 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622447 2:221573584-221573606 GAGCAGGGCCGAGTTTTCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 138
946622432_946622452 27 Left 946622432 2:221573549-221573571 CCCTTCCCAGGCCGCCCCTCCTC 0: 1
1: 0
2: 15
3: 84
4: 816
Right 946622452 2:221573599-221573621 TTCCTGGGGAGCCTGGGTCCCGG 0: 1
1: 0
2: 3
3: 41
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946622432 Original CRISPR GAGGAGGGGCGGCCTGGGAA GGG (reversed) Intronic
900185552 1:1331542-1331564 GAGGTGGGACGGCCTGGGTCGGG + Intronic
900204557 1:1426504-1426526 GAGAAGGGGCTGCCAGGGAGGGG - Intronic
900495668 1:2974937-2974959 GAGAAGGGGCCGCCAGGGAGGGG - Intergenic
900538270 1:3189759-3189781 GAGGAGAGGGGGTCTGGGAGTGG + Intronic
901068566 1:6506201-6506223 GAGGCTGGGTGGCCTGGGGACGG + Intronic
901185222 1:7368553-7368575 GTGGGGGTGGGGCCTGGGAAGGG - Intronic
901206642 1:7501320-7501342 GAGGAAGGGAGGCCTGAGAACGG + Intronic
902178557 1:14670099-14670121 GGGGAGGGGAGGGCTGGGGAGGG - Intronic
902233482 1:15043085-15043107 CAGGAGGGCCAGCCTGGGGAGGG + Intronic
902258459 1:15206267-15206289 GAGGAGGGGAGGGGAGGGAAGGG + Intronic
902334950 1:15749347-15749369 GAGGAGGGGAGGCCTGGAGAGGG + Intergenic
902398854 1:16146585-16146607 AAGCAGGGGCCGCCTGGGGAAGG + Intronic
902412055 1:16217497-16217519 GAGGGAGGCCGGCCTGGGAGAGG - Intergenic
902502736 1:16921828-16921850 GAGGAGGGAGGGGATGGGAAAGG - Intronic
902529680 1:17082767-17082789 GAGGATGGGGGACCAGGGAATGG - Intronic
902791148 1:18769149-18769171 GAGGAGGGGAGGGCAGGGAGGGG - Intergenic
902826656 1:18979210-18979232 TTGGAGGGTCGGCTTGGGAAAGG + Intergenic
903178886 1:21595591-21595613 GATGAGGGGCAGCCGGGGACAGG - Intergenic
903211051 1:21818883-21818905 GAGGAGGCGGGGCCAGGGAGGGG - Intronic
903353530 1:22732295-22732317 GAGCTGCGGGGGCCTGGGAAAGG + Intronic
903623224 1:24713229-24713251 GGAGAGGGGCAGCCTGGGCACGG - Intergenic
904413012 1:30336316-30336338 GAGGAGGCAGGGCCTGGGAATGG - Intergenic
904614726 1:31743554-31743576 GAGCAGGGCCTACCTGGGAAGGG - Intronic
904895187 1:33812021-33812043 TAGGAAGGGTGTCCTGGGAAAGG - Intronic
905124768 1:35708557-35708579 GAGGAGGGGGGATCTGGGCAAGG + Intergenic
905593737 1:39187946-39187968 GAGGAGGGGAGGGAAGGGAAGGG - Intronic
905657109 1:39692110-39692132 GAGGAGGGCCCGTCTGGGGAGGG - Intergenic
905771208 1:40639114-40639136 GAGGAAGGAGGCCCTGGGAAGGG + Intronic
906146905 1:43565757-43565779 GAGGAGCCGGGGCCTGGGAAGGG + Intronic
906223618 1:44103270-44103292 CAGGAGGGGCAGGCTGGGAGGGG + Intergenic
906315910 1:44786367-44786389 GAGCAGGGGCCTCCAGGGAAGGG - Intronic
906509126 1:46400992-46401014 GAGGAGGGGAAGCCAGGGGAGGG + Intronic
906720070 1:47997702-47997724 GAGGAGGCGCGGGCAGGGGAGGG - Intergenic
906951750 1:50340697-50340719 GAAGAGGGATGGCCTGGGATAGG - Intergenic
907179124 1:52553754-52553776 GAGGAAGGCCGGCCTGGAATGGG + Intergenic
907280498 1:53344098-53344120 GAGGAGAGGCAGCCTGGCAGGGG - Intergenic
907678351 1:56539657-56539679 GAGGAGAGGGGGGCAGGGAAAGG + Intronic
908021221 1:59900904-59900926 GAGCAGGGGAGGGCTGGGAGAGG + Intronic
908128164 1:61050582-61050604 CAGGAGCTGCGGCTTGGGAAGGG + Intronic
908322545 1:62992188-62992210 GAGGAAGGGAGGGCTGGGGAGGG - Intergenic
908982762 1:69978307-69978329 GAGGAGGGGAGGGGAGGGAAAGG + Intronic
909134593 1:71782137-71782159 TAGGAGGTGGGGCCTTGGAAAGG + Intronic
910654416 1:89605426-89605448 GAGGAGGGACGGCCAAGAAATGG + Intergenic
910705577 1:90126028-90126050 CGGGAGGGGCGGGGTGGGAAGGG + Intergenic
911092884 1:94031716-94031738 GAGGAGGGGAAGGCTGGGAGAGG + Intronic
911104707 1:94120698-94120720 GGGGAGGGGCGGGCAGGCAATGG + Intronic
912473068 1:109918934-109918956 GAGGATGGGGGACCTGGCAAGGG + Intronic
912497177 1:110099023-110099045 GAGGAGGGATGTCATGGGAAGGG - Intergenic
912514123 1:110207444-110207466 GTGGAGGGGGGGCCTGGAAAGGG + Intergenic
912521683 1:110250144-110250166 GAGGTGGGGGAGCCCGGGAAAGG - Intronic
912652112 1:111448997-111449019 GGGGAGGGGCGCCCTGGGCCGGG + Exonic
912790003 1:112640525-112640547 CAGGAGGGGCGGCCGGGCAGAGG - Intronic
912797531 1:112701902-112701924 GAGGTGGGGCTGCATGGGAATGG - Intronic
913283900 1:117210293-117210315 GAGCTGGGGGGGCCTGGGGAGGG + Intronic
913333651 1:117687567-117687589 GAGGAAGGGTGGCATGGGAATGG - Intergenic
913997859 1:143666045-143666067 GAGGATGTGCAGCCTGGGGATGG + Intergenic
914690034 1:150017609-150017631 AATGAGGAGAGGCCTGGGAATGG + Intergenic
914919892 1:151839540-151839562 GAGCCGGGGCAGCCTGGCAAAGG - Intronic
915463518 1:156082815-156082837 GAGGAGGGGGGGCCGGGGCCGGG + Intronic
915518884 1:156429964-156429986 GTTGAGGGGAGGCCTGGGAAGGG - Intronic
916942406 1:169689558-169689580 GAGGAGGAAGGGCCTGGGACAGG - Intronic
917513023 1:175683686-175683708 GGGGAGGGGAGGGCAGGGAAAGG + Intronic
917846652 1:179025918-179025940 GGCGAGAGGTGGCCTGGGAATGG + Exonic
917929866 1:179815718-179815740 GAGGAGGGTGGGGCAGGGAAAGG + Exonic
917932027 1:179829117-179829139 CAGGACTGGCAGCCTGGGAAGGG - Intergenic
919747279 1:201016781-201016803 CAGGAGGGCTGGCCTGGGGAAGG - Intronic
919765919 1:201127287-201127309 GAGGAGGGGCGGCAGGGGGTGGG + Intergenic
919795433 1:201318841-201318863 GAGATGGGGCTGCCTGGGGAAGG - Intronic
920117046 1:203628643-203628665 GAGAAGGGGCAGCTTGGGGAGGG - Intronic
921068609 1:211640501-211640523 GTGGAGGGGAGGATTGGGAAGGG + Intergenic
921247543 1:213260298-213260320 GAAGAGGGTGGGCTTGGGAAGGG + Intronic
921377784 1:214492012-214492034 GAGGATGGGCAGCCTGAAAATGG - Intronic
922505139 1:226121867-226121889 GAGCAGGGGCGGGCGGGGAGCGG + Intergenic
922617838 1:226973648-226973670 GAGGACAGGGGGCCTGGGGAGGG - Intronic
923072345 1:230577571-230577593 GGGGAGGGCCCGCCAGGGAAGGG - Intergenic
923109478 1:230879650-230879672 GAGGAGGGGGAGGCTGGCAAAGG - Intergenic
923738319 1:236633040-236633062 GGGGAGGGGAGGCCAGGGGAGGG - Intergenic
924158766 1:241208550-241208572 GGGGCGGGGCTGACTGGGAAGGG - Intronic
924665126 1:246063582-246063604 GAGGAGGGGAGGGGAGGGAATGG - Intronic
1062818166 10:516346-516368 GAGGAGGGGGGGGATGGGGAGGG + Intronic
1063092235 10:2875338-2875360 GAGTAAGGGCGACCAGGGAAGGG + Intergenic
1063157335 10:3391700-3391722 GAGGAGGGGAGGGAAGGGAAGGG + Intergenic
1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG + Intergenic
1065220372 10:23490517-23490539 GAGGAGGGGGGTCCTGGAAGGGG + Intergenic
1065326166 10:24552453-24552475 GAGGAGGTGGGGCCTGGTACGGG - Intergenic
1066249160 10:33616193-33616215 GAGGAGGGGTGGCTAGGCAATGG - Intergenic
1066298938 10:34079954-34079976 GGAGAGGCGCTGCCTGGGAAGGG - Intergenic
1066745475 10:38602025-38602047 GGGCAGGGGCAGCCTGGGAGGGG + Intergenic
1067922687 10:50476321-50476343 GAGGAGGGGAGGGGAGGGAAGGG + Intronic
1069362901 10:67663555-67663577 CAGGAGGGGCAGGCTGGGAGGGG + Intronic
1069381772 10:67849265-67849287 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1069706175 10:70460182-70460204 GGGGAGGGGAGGCCTGGGGCAGG - Intergenic
1069901872 10:71711071-71711093 GGGCATGGGCGGGCTGGGAAGGG - Intronic
1069961834 10:72083726-72083748 GTGGAGGGGAGGTCAGGGAAAGG + Intronic
1069974055 10:72198256-72198278 GAGGAGGGGAGGGGAGGGAAGGG + Intronic
1070328521 10:75402755-75402777 GAGGAGCGGCCTCCTGGGATGGG + Intergenic
1070610178 10:77927122-77927144 CCGGAGGGACGGCCTGGGGAGGG - Intergenic
1070644607 10:78192990-78193012 GAGAAGGGGCTGCCTGCAAAGGG - Intergenic
1070821541 10:79358376-79358398 GAGGAGGGGCTGCCTTGGGTGGG + Intergenic
1071253541 10:83845210-83845232 GGGGTGGGGGGGCCAGGGAAGGG - Intergenic
1071597786 10:86940696-86940718 GGGCAGGGGCTGCCTGGGACGGG + Intronic
1072432304 10:95384006-95384028 GAGGAAGAGCGGGCTGGGAGGGG + Exonic
1072787756 10:98295767-98295789 GAGGAGGGGCTGCCTGTGATGGG - Intergenic
1073207430 10:101776293-101776315 GGGGCGGGGCGGCCGGGGAGGGG + Intronic
1074103859 10:110374599-110374621 GAAGAGGGGCTTCCTGGGGAAGG - Intergenic
1075136885 10:119794584-119794606 CAGTAGGGGCGGCCGGGCAAAGG + Intronic
1075627213 10:123972235-123972257 GAGGAGGGGAGGGGAGGGAAAGG + Intergenic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1076096610 10:127738290-127738312 GAGGAAGGGAGCCCTGGGAAAGG - Intronic
1076509065 10:130999391-130999413 GAGGAGGGGCCGGATGGGTAGGG + Intergenic
1076711659 10:132339080-132339102 CAGGAGGGGCAGCCTGGGCGTGG + Intronic
1076873563 10:133205142-133205164 GAGGAGGGGCGCCCTGAGGATGG - Intronic
1077023645 11:430498-430520 GGGGAGGGACGGGGTGGGAAGGG + Intronic
1077077198 11:707110-707132 GAGGAGGGGCCGCGAGGGGAGGG - Intronic
1077231071 11:1458445-1458467 GAGGGGGGCAGGGCTGGGAAGGG - Intronic
1077295109 11:1822902-1822924 GAGGAGGGTTGGCCTGGGGGTGG - Intergenic
1077299534 11:1840664-1840686 GAGGCGGGGTGGCCGGGGAGGGG - Intronic
1077499265 11:2901954-2901976 GAGGAGGGGCAGTGTGGGCAGGG - Intronic
1077500548 11:2908072-2908094 GAGCAGGGTCCCCCTGGGAAGGG + Intronic
1077555816 11:3225541-3225563 GAGGAGGCGCAGGCTGGGCAGGG + Intergenic
1077606916 11:3618485-3618507 GAGAAGCTGAGGCCTGGGAAGGG + Intergenic
1077730254 11:4722699-4722721 CAGGAGGGGCAGGCTGGGAGGGG + Intronic
1078011074 11:7573695-7573717 GAGAAGGGGAGGCGGGGGAAGGG - Intronic
1078352689 11:10607606-10607628 GGGGCGGGGAGGCCTGGGAGGGG + Intronic
1078567356 11:12427989-12428011 GAGGAGGGGAGGCCTGGAGATGG - Intronic
1078826515 11:14935460-14935482 GAAGAGGGGAGGGCAGGGAAGGG + Intronic
1078826540 11:14935520-14935542 GAGGAGGGGAGGGAAGGGAAAGG + Intronic
1079096890 11:17516926-17516948 GTGGAGCTGCGGCCTGGGGAAGG - Intronic
1079134475 11:17768615-17768637 GGGGGGGGGCGGTTTGGGAATGG + Intronic
1079945170 11:26732871-26732893 GAGCAGGGGTGCCCTGGGACAGG - Intergenic
1080230863 11:30016862-30016884 CAGGAGGGATTGCCTGGGAAAGG + Exonic
1081576620 11:44322608-44322630 GAGGAGGAGAGGCTGGGGAAAGG + Intergenic
1081657958 11:44869793-44869815 GAGGAGGGTGGGCCTGGGAGGGG - Intronic
1081740088 11:45433042-45433064 CAGGAGGCGCGGCCTGGGGCTGG + Intergenic
1082767322 11:57180147-57180169 GAGGAGGAGAGGCCGGGGGAGGG + Intergenic
1083486002 11:62983451-62983473 CAGGAGGGGCAGGCTGGGAGGGG + Intronic
1083611253 11:64005495-64005517 CAGGAAGGGGGGCCTGGGCAAGG + Intronic
1083728658 11:64641768-64641790 CAGGAGGGGAAGCCTGGAAACGG + Intronic
1083735375 11:64677311-64677333 GAGGAGGGGCGGGGTAGGGATGG - Intronic
1083952079 11:65962096-65962118 GAGGAGGCGGGGCCTGCGCAGGG + Intronic
1084106438 11:66983855-66983877 AAGGTGGAGCGGCATGGGAAAGG + Intergenic
1084117880 11:67052561-67052583 GATGTGGGGTGGCCTGAGAAAGG - Intergenic
1084161715 11:67353715-67353737 GAGGAGGGGCAGGCTGGGGCGGG + Intronic
1084186920 11:67477995-67478017 CAGGAGGGGCGGCCGGGCAGAGG + Intergenic
1084195133 11:67520206-67520228 GAGGAGGGAGGGCCAGGGAGGGG - Intronic
1084371932 11:68750744-68750766 GGGGAGGGGCGGCCAGGAAAGGG + Intronic
1084371952 11:68750790-68750812 AGGGAGGGGCGGCCAGGGGAGGG + Intronic
1084372038 11:68751007-68751029 GGGGAGGGGCGGCCGGGGAGGGG + Intronic
1084372058 11:68751049-68751071 GGGGAGGGGCGGCCAGGGGAGGG + Intronic
1084372085 11:68751120-68751142 GGGGAGGGGCGACCAGGTAAGGG + Intronic
1084928675 11:72535923-72535945 GGGGAGGGGAGGGGTGGGAAGGG + Intergenic
1085037194 11:73307755-73307777 GAGGAGGCGTGGCCTGGGCGGGG + Intergenic
1085199072 11:74690793-74690815 TAGCAGTGGCGGCCTGGGAACGG + Intergenic
1085384708 11:76150349-76150371 GAAGAGGGACAGCCTGGGATGGG + Intergenic
1085507875 11:77070372-77070394 GAGCAGGGGCTGGCTGGGCAGGG - Intronic
1086555855 11:88110372-88110394 GAGGGTGGGGGGCCAGGGAAGGG + Intergenic
1088814280 11:113410666-113410688 GAGGCTGGCCGGCCTGGGCAGGG + Exonic
1089394818 11:118129697-118129719 GAGCCAGGGCGGCCTGGGCAAGG + Intergenic
1089529436 11:119116802-119116824 GAGCAGGGCCGGCCCGGGATGGG + Exonic
1089560717 11:119341817-119341839 AAGGAGGGCGGGCCTGGGAGGGG - Intronic
1089599146 11:119602824-119602846 CAGGAGGGGCAGGCTGGGAGGGG + Intergenic
1089660183 11:119980628-119980650 GAGGAGCGGAGGCCTAGGGAAGG + Intergenic
1090190486 11:124763126-124763148 GAGGAGGGGCGGCTGCGGGAAGG + Intergenic
1090344451 11:126057540-126057562 GAGGGAGGGCTGCCTGGGATGGG + Intronic
1090362315 11:126182211-126182233 GGGGAGGGACAGCCTGGGAGGGG - Intergenic
1090484643 11:127102197-127102219 GAGGAGGAGAGGGCAGGGAAGGG - Intergenic
1090666602 11:128918727-128918749 GGGGTGGGGCAGCCTGGGACGGG + Exonic
1091041242 11:132283945-132283967 GAGGAGAGGAGGCCAGGAAAAGG - Intronic
1091142167 11:133244571-133244593 GAGGAGGGGCCTCGTGGGAGGGG + Intronic
1091364344 11:135005202-135005224 GAGGAGGGATGGGGTGGGAAGGG - Intergenic
1091390942 12:125754-125776 GAGGAGGAGCGGCCGGGGGCAGG + Exonic
1091829142 12:3536774-3536796 GAGGAAGGGCAGCCTGGAAGTGG + Intronic
1091916329 12:4273656-4273678 GAGGAGGGGAGGACCGGGAGGGG + Intergenic
1091986633 12:4915029-4915051 CAGGAGGGAAGGCCTAGGAAAGG - Exonic
1092092122 12:5812100-5812122 GGGGAGGCGAGGCCAGGGAAGGG + Intronic
1092461011 12:8686256-8686278 GAGGAGGGGAGGGGAGGGAAGGG - Intronic
1092476652 12:8824631-8824653 GATGAGGGGTGGGGTGGGAATGG - Intronic
1092532976 12:9360502-9360524 GTGGAGTGGCAGCCAGGGAATGG - Intergenic
1093256416 12:16873551-16873573 GGGGAGTGGGGGCCTGGGGAGGG - Intergenic
1094203574 12:27817371-27817393 AAGGAGGGGAGGGCAGGGAAGGG - Intergenic
1096077647 12:48815157-48815179 GAGGATGGGCGGCCGGCGCACGG + Intronic
1096452507 12:51756171-51756193 GACGAGGGGTGGCCTGGTGAGGG - Intronic
1096475536 12:51907065-51907087 GCGGAGGGGCCGCCTGGAATCGG - Intronic
1096513388 12:52144067-52144089 GAGGTGGGGAGCCCTGGGGAAGG - Intergenic
1098721959 12:73911750-73911772 TAGGAGGGGTGGGGTGGGAATGG - Intergenic
1098883989 12:75942415-75942437 CAGGAGGGGCGGCCAGGCAGAGG - Intergenic
1100065722 12:90641516-90641538 AAGGAAGGGAGGCATGGGAAGGG + Intergenic
1100540286 12:95550881-95550903 GAAGAGGTGCGGAGTGGGAAGGG + Intronic
1100931457 12:99614459-99614481 GAGGAGGGGAGGGGAGGGAAGGG + Intronic
1101647486 12:106644880-106644902 GAGGAGGGCAGGCCCAGGAAAGG + Intronic
1101693061 12:107098481-107098503 GAGGAGGGGAGGGAAGGGAAGGG + Intergenic
1101911036 12:108860015-108860037 GAGGAGGGGAGGGGAGGGAAAGG + Intronic
1103350064 12:120278036-120278058 CAGGCGGGGCGGCCTGGCAGAGG + Intergenic
1103608228 12:122104294-122104316 AAGGAGAGGATGCCTGGGAAGGG - Intronic
1103682896 12:122708820-122708842 CAGGAGGGGCGGCCGGGCAGAGG + Intergenic
1103800480 12:123534112-123534134 GGGGAGGGGCGGCCGGGGCACGG - Intergenic
1104991449 12:132625957-132625979 GGTGTGGGGAGGCCTGGGAAGGG + Intronic
1106560008 13:30839361-30839383 CAGTAGGGGCGGCCGGGCAAAGG + Intergenic
1106746988 13:32716895-32716917 CAGTAGGGGCGGCCAGGCAAAGG - Intronic
1107212069 13:37869815-37869837 GGGGAGGGGCGGCCCGGGAGGGG + Exonic
1107603920 13:42040491-42040513 GAGGAGGGGCGGCGGGGGGGAGG + Intronic
1108396766 13:49997315-49997337 GGGGAGGAGCGGCCTGCGGAGGG + Intronic
1113567090 13:111325589-111325611 GTGGAGGGCCGGGCTAGGAATGG + Intronic
1113835418 13:113325612-113325634 GAGGCGGGGCCCCCTGGGAGGGG + Exonic
1113867346 13:113535766-113535788 GAGGATGGGCAGTCTGGGGAGGG + Intronic
1114183311 14:20382789-20382811 GAGGAGGAGCTGCCTGGCAGAGG - Intronic
1114318470 14:21526951-21526973 GAGGAGGGGCGGGGAGTGAAGGG - Intronic
1114683683 14:24507748-24507770 GAGGAGGGTGGGCCAGGGCAAGG - Intronic
1115576264 14:34714746-34714768 CAGAAGGGCCGGCCTGGGAGCGG - Intronic
1116788925 14:49318872-49318894 GAGGAGGGGAGGGCAGGGGAGGG + Intergenic
1117215947 14:53551936-53551958 GAAGAGTGGAGGCCAGGGAAAGG + Intergenic
1117237771 14:53796881-53796903 GAGGAGGAGCTGGCTGTGAAAGG - Intergenic
1117406810 14:55411884-55411906 CAGGAGGAGGGGCCTGGGGAAGG + Intergenic
1119123504 14:72101601-72101623 GAGGGGTTGCTGCCTGGGAAAGG + Intronic
1119298156 14:73549850-73549872 GAGGAAGGGCTCCCAGGGAAGGG - Intronic
1119302445 14:73582034-73582056 GAGGAAGGGCTCCCAGGGAAGGG - Intergenic
1119573331 14:75695791-75695813 GGGGAGGGGAGGGCAGGGAAGGG - Intronic
1120956557 14:90088488-90088510 GAGGTGGAGCTGGCTGGGAAAGG - Intronic
1121177443 14:91901369-91901391 GAAGAGTGGAGGCCTTGGAAAGG - Intronic
1121282703 14:92710792-92710814 GCAGAGGGACGGCCAGGGAAAGG - Intronic
1121325363 14:93016609-93016631 GAGGAGGGGAGGCCCTGGAATGG - Intronic
1121464884 14:94109330-94109352 GGGGAGGGGAGGGCAGGGAAGGG + Intronic
1121514194 14:94538415-94538437 GAGGAGGGTCAGCCTGGGGTAGG + Intergenic
1121708218 14:96017158-96017180 GAGGAGGAGCAGAGTGGGAAAGG - Intergenic
1122007765 14:98719276-98719298 GGGGAGAGGAGGCCAGGGAAGGG + Intergenic
1122113484 14:99516668-99516690 GAGGAAGGGGGGCATGGGAGTGG + Intronic
1122361804 14:101171972-101171994 TAGGAGGTGGGGCCTTGGAAAGG - Intergenic
1122366855 14:101199453-101199475 GAGGAAGGGAGGGCAGGGAAAGG - Intergenic
1122419065 14:101564077-101564099 GAGGAGGGGGGTCCTGGGCAGGG - Intergenic
1122497886 14:102172598-102172620 CAGTAGGGGCGGCCTGGCAGAGG + Intronic
1122598255 14:102908183-102908205 CAGGAGCGTCTGCCTGGGAAGGG - Exonic
1122898375 14:104771686-104771708 GGGGAGGGGCAGGCTGGGAACGG + Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123059040 14:105586131-105586153 GAGCAGGGGCTGCCTGGGAGGGG + Intergenic
1123083370 14:105706362-105706384 GAGCAGGGGCTGCCTGGGAGGGG + Intergenic
1123434902 15:20247799-20247821 GAGGAGGGGAAGGATGGGAAGGG + Intergenic
1123582008 15:21724192-21724214 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1123618655 15:22166788-22166810 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1123919500 15:25060454-25060476 CAGGTGGGGCCGCCTGGCAATGG - Intergenic
1123920417 15:25065966-25065988 CAGGTGGGGCCGCCTGGCAATGG - Intergenic
1124121795 15:26894333-26894355 GTGCAGGCGCGGCCTGTGAAGGG - Intronic
1124414588 15:29464713-29464735 GTGGAGGGGCCCCCTGGGCAGGG + Intronic
1124553911 15:30708437-30708459 GAGGAGGGGCCGCCTGGGGAAGG + Intronic
1124677338 15:31697234-31697256 GAGGAGGGGCCGCCTGGGGAAGG - Intronic
1125031845 15:35082245-35082267 CAGAAGGGGCGGCCTGGCAGAGG - Intergenic
1125420738 15:39501550-39501572 GAGGACCGGGGTCCTGGGAAAGG + Intergenic
1125750096 15:42022012-42022034 GAGGAGGGGAGGGCAGGGCAAGG - Intronic
1126053896 15:44711766-44711788 GCGGCGGGGTGGCCTGGGAGTGG + Intronic
1126121091 15:45252188-45252210 GAGGAGGGGCAGCTTGGGTGGGG - Intergenic
1126324866 15:47465551-47465573 GAGGAGGGGCCTGGTGGGAAGGG + Intronic
1126899889 15:53304299-53304321 GAGAAAGGGCTGCCTGGCAAGGG + Intergenic
1127804432 15:62505826-62505848 GATGGGGGGCGGACGGGGAAGGG + Intronic
1128226616 15:66006182-66006204 GAGGAGAGGCAGGCTGGGACTGG + Intronic
1128685919 15:69685601-69685623 GAGGAAGTGCTGACTGGGAAAGG - Intergenic
1128743840 15:70100288-70100310 GAGGAGGGGTGGCCTGTGAAAGG + Intergenic
1129051262 15:72783726-72783748 GAAGAGGCGCGGGCTAGGAAAGG - Exonic
1129162147 15:73752945-73752967 GAGGAGGCGCGGCGAGGGGAAGG + Intergenic
1129250770 15:74307874-74307896 GAGGGGTGGGGGCCTGGGAGTGG - Intronic
1129463059 15:75709662-75709684 CAGGAGGGGCGGGCAGGGGAGGG - Intronic
1129645026 15:77421154-77421176 GAGGAAGGCCGTCCTGGGGAGGG + Intronic
1129673901 15:77622107-77622129 GAGGATGGCAGGCCTGGGAAGGG + Intronic
1129705562 15:77792211-77792233 GGAGAGGGCCAGCCTGGGAATGG - Intronic
1129793077 15:78354820-78354842 GAGGAGGGGGTGCCTCTGAAAGG - Intergenic
1129890966 15:79071728-79071750 GGGGAGGGAAGACCTGGGAAGGG - Intronic
1130114285 15:80992841-80992863 TAGGAGGAGAGGCCTGGGGATGG + Intergenic
1130139176 15:81209279-81209301 GGGGAGGGGCGTCCTGGGGGAGG + Intronic
1130141397 15:81229283-81229305 GGGGAGGGGCGTCCTGGGGGAGG + Intronic
1130398009 15:83521454-83521476 GGGGAGGGGAGAGCTGGGAATGG + Intronic
1130675465 15:85948280-85948302 GAGGTGGGGCGTCCAGGGGATGG - Intergenic
1131057381 15:89383717-89383739 GAGGAGGGGCAGCCAGGAGAGGG - Intergenic
1131121574 15:89826318-89826340 GATGAGTGGCTGCCTGGGAATGG - Intergenic
1132368613 15:101277228-101277250 GAGCCTGGGAGGCCTGGGAACGG - Intronic
1132393984 15:101459072-101459094 GAGGAGAGGTGGCCTGGAGAGGG - Intronic
1132414409 15:101610350-101610372 TAGCAGGGACGGCTTGGGAAGGG - Intergenic
1132419305 15:101652084-101652106 GCGGAGGGGCGGCCTCGGGCCGG + Intronic
1132520199 16:383763-383785 GAGGAGAGGCGGGGTGGGGATGG + Intronic
1132527676 16:425767-425789 GCGGCGGGGCGGCCTAGGGAGGG - Exonic
1132584748 16:701216-701238 GAGGAGCGGCCGTCTGGGTATGG + Intronic
1132846652 16:2003892-2003914 GAGGAGGGGAGGCCTAGGCCAGG - Intronic
1132973475 16:2700311-2700333 AAGGGGAGGCAGCCTGGGAAAGG - Intronic
1133074702 16:3271366-3271388 CAGAAGGGGCGGCCGGGCAAAGG + Intronic
1133768786 16:8855714-8855736 GTTGAGGGGTGGCCTGGGCAGGG + Intronic
1134754055 16:16650730-16650752 GAGGAGGGGAGGCAAGGGAAGGG - Intergenic
1134992004 16:18708314-18708336 GAGGAGGGGAGGCAAGGGAAGGG + Intergenic
1134998366 16:18756779-18756801 CAGAAAGGGTGGCCTGGGAAGGG - Intergenic
1135392817 16:22107879-22107901 GAGGAGGGGCTCTCTAGGAAAGG + Intronic
1135565879 16:23510543-23510565 GTGGAGGGGGGGCCTGGGGTGGG - Intronic
1136069570 16:27779637-27779659 AAGGGGTGGGGGCCTGGGAAAGG - Exonic
1136332880 16:29593090-29593112 GGGGAGGGGCGATGTGGGAAGGG - Intergenic
1136447575 16:30333179-30333201 GGGGAGGGGCGATGTGGGAAGGG - Intergenic
1136552784 16:30990343-30990365 GCAGAGGGGCGTTCTGGGAAGGG + Exonic
1136683543 16:31981495-31981517 GATGAGGGGCAGCCTGGGGAGGG + Intergenic
1136784174 16:32925055-32925077 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1136866988 16:33766913-33766935 GATGAGGGGCTCCCTGGGGATGG - Intergenic
1136885610 16:33928751-33928773 GGTGAGGGGCAGCCTGGGGAGGG - Intergenic
1137588241 16:49677343-49677365 GAGGAGGGGAGGGGAGGGAAGGG + Intronic
1137615233 16:49842296-49842318 GGGGAGGGGAGGCGAGGGAAGGG + Intronic
1137706603 16:50539812-50539834 GTGGGGGGGGGGCCTGGGGAAGG + Intergenic
1138265986 16:55660064-55660086 GAGGAAGGGCTGCTTAGGAAGGG + Intronic
1138280812 16:55771132-55771154 GAGGAGGGGGGACCAGGAAAGGG - Intergenic
1138335118 16:56246786-56246808 GAGGAGAGGCATTCTGGGAAAGG - Intronic
1138647917 16:58438661-58438683 GAGGGGGAGAGGCCAGGGAATGG + Intergenic
1139265553 16:65635355-65635377 GAGGAAGGTCAGCCTGGAAAAGG - Intergenic
1139363624 16:66419293-66419315 GAGGAGGGGAGGGGAGGGAAGGG + Intergenic
1139967201 16:70752400-70752422 AAGGAGGGGAGACCTTGGAATGG - Intronic
1141526386 16:84614523-84614545 GAGGTGGGAGGGCCAGGGAAGGG + Intronic
1141603015 16:85137582-85137604 CAGGAGGGGTGGCCTGGGTCTGG + Intergenic
1141703002 16:85651033-85651055 GAGGAGGGGCGGAGGGGGAGGGG - Intronic
1141703015 16:85651056-85651078 GAGGAGGGGCGGAGGGGGAGGGG - Intronic
1141841915 16:86579060-86579082 GAGAAAGGGCGGCCGGGCAAGGG + Exonic
1142026731 16:87818420-87818442 GAGGAGGGGGAGCCAGGGCAGGG + Intergenic
1142145203 16:88489986-88490008 GAGGAGGGACAGCGTGGGGAGGG + Intronic
1142267230 16:89070299-89070321 TGGGAGGGTCTGCCTGGGAATGG + Intergenic
1142271050 16:89089414-89089436 GAGGAGAGGTGCCCTGGGGAGGG - Intronic
1142285953 16:89171629-89171651 GCCGAGGGCCGGCCTGGGCAGGG - Intergenic
1142288653 16:89182262-89182284 GGGGAGGGGAGGCTTGGGGAGGG - Intronic
1203086829 16_KI270728v1_random:1189061-1189083 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1203105174 16_KI270728v1_random:1349289-1349311 GATGAGGGGCTCCCTGGGGATGG + Intergenic
1203128340 16_KI270728v1_random:1613079-1613101 GATGAGGGGCTCCCTGGGGATGG - Intergenic
1142490239 17:273909-273931 GAGGGGGGGTGGCCTAGAAAGGG - Intronic
1142502500 17:340622-340644 GATGTGGGGAGGCCTGGGAGGGG - Intronic
1142502575 17:340838-340860 GATGTGGGGAGGCCTGGGAGGGG - Intronic
1142502613 17:340945-340967 GATGTGGGGAGGCCTGGGAGGGG - Intronic
1142502638 17:341016-341038 GATGTGGGGAGGCCTGGGAGGGG - Intronic
1142502660 17:341086-341108 GATGTGGGGAGGCCTGGGAGGGG - Intronic
1142535612 17:615854-615876 GGGAAGGGGCTGCCTGGGCAAGG - Intronic
1142683222 17:1562309-1562331 GTGGAGGGGCGGCCGGGGCGTGG - Intronic
1142709618 17:1716006-1716028 GAGAAGGGGCGGCGGGGGCAGGG - Intergenic
1142748374 17:1972468-1972490 CAGGAGGGGTGGCCTGAGAGCGG - Intronic
1143092655 17:4458122-4458144 GAGGAGGGTAGGCCTGGGAGAGG - Intronic
1143514207 17:7411312-7411334 GAGGAGAGGAAGCCTGGGTAAGG + Intronic
1143524844 17:7466097-7466119 GGGGAGGGGCCGCCGGGGCAGGG + Exonic
1143919559 17:10320095-10320117 GAGGAGGGGCGCTCTTGCAAAGG + Intronic
1143965579 17:10754518-10754540 GAGGAGGGACAGCTTGAGAAAGG - Intergenic
1144213663 17:13035988-13036010 GAGAGGGGACTGCCTGGGAAGGG - Intergenic
1144661389 17:17073105-17073127 GAGGAGTGGCTGCCTGGGGCTGG - Intronic
1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG + Intergenic
1145908462 17:28529029-28529051 GAGGAGGGCCCTCCTGGGAAAGG + Intronic
1146061970 17:29612506-29612528 GAGGAGTCGCTGCCTGGGGAAGG - Exonic
1146180977 17:30697972-30697994 CAGGAGGGGCAGCCCGGGGAAGG - Intergenic
1146268354 17:31467986-31468008 GTGAAGGAGGGGCCTGGGAAGGG + Intronic
1146523094 17:33541743-33541765 GAGAAGTGGCTGCTTGGGAAGGG - Intronic
1147144457 17:38477202-38477224 GATGAGGGGCAGCCTGGGGAGGG + Intronic
1147168300 17:38604807-38604829 GTGGAGGGTGGGGCTGGGAAGGG - Intronic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147424936 17:40341971-40341993 AAGTGGGGGCAGCCTGGGAAGGG - Intronic
1147609466 17:41793163-41793185 AAGGAGGGGCAGCCTGGGACAGG - Intergenic
1147669969 17:42171226-42171248 GAGGTGGAGTGGACTGGGAAGGG + Intronic
1147718221 17:42522080-42522102 CAGGAGGGGTGTCCTGGGCAGGG + Exonic
1147880074 17:43647725-43647747 GAGGAGAGGTGGCCAGGGATGGG - Intronic
1148106501 17:45121507-45121529 GAGGAGGGGAGTCCTGTGAGGGG - Intronic
1148143053 17:45341957-45341979 GAGGAAGGGAGGCCTGGAGAAGG - Intergenic
1148645852 17:49219442-49219464 GAGGAGGGGCGGACGGGAACCGG - Intronic
1148756850 17:49977693-49977715 GAGGAGGGGCAGCCTGTCACTGG - Intergenic
1148821428 17:50361955-50361977 GGGGAGAGGAGGCTTGGGAAAGG - Intronic
1149533876 17:57417088-57417110 AAGGATGGGAGGCCTGGGAGAGG - Intronic
1149568010 17:57653088-57653110 GAGGAGGGTGGGGCTGGGCAGGG + Intronic
1149993998 17:61397386-61397408 GGGGAGGGGGTTCCTGGGAAGGG + Intergenic
1150157764 17:62868604-62868626 GAGTAGGGGGGGCCTAGGAAGGG - Intergenic
1150416914 17:64995416-64995438 GAGGAGGGGAGGCAAGGGCAGGG + Intergenic
1150489031 17:65561749-65561771 GCGGAGGAGAGGCCGGGGAAGGG - Intronic
1150601297 17:66653154-66653176 GGGCAGGGGCTGCCTGGGATTGG + Intronic
1150815472 17:68389161-68389183 GAGGAGGAGAGGACTTGGAAAGG - Intronic
1150840235 17:68600512-68600534 GAGGAGGCGCGGCCGGTGCACGG + Exonic
1151570067 17:74921607-74921629 CAGGAGGGGAGGCCCAGGAAGGG - Intronic
1151621296 17:75246662-75246684 GAGAGGGAGCGGACTGGGAAGGG - Intronic
1151714644 17:75825198-75825220 GGGGAGGGGCGGCGGGGGGAAGG - Exonic
1151957269 17:77386633-77386655 GATGAGGTGTGGCCTGGGAGGGG + Intronic
1151958486 17:77392638-77392660 GAGGGGGAGGGGACTGGGAAAGG + Intronic
1152097041 17:78278415-78278437 GTGGAGGGGCCGCTGGGGAAGGG + Intergenic
1152410537 17:80120502-80120524 GAGGAGAGGTGACATGGGAAGGG - Intergenic
1152614154 17:81330233-81330255 CAGGAGGGGCCCCCTAGGAAGGG - Exonic
1152636563 17:81432769-81432791 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152636588 17:81432818-81432840 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152656059 17:81519670-81519692 GAGGCAGGGCTGCCTGGGGAGGG + Intronic
1152783489 17:82236618-82236640 GGGGAGGGGTGGTGTGGGAAGGG + Intronic
1152799571 17:82324507-82324529 GAGGGGAGGGGGCCTGGGCAGGG - Intronic
1152820206 17:82433966-82433988 GTGGATGGGCGGCCTGGCACGGG + Intronic
1152820227 17:82434049-82434071 GTGGATGGGCGGCCTGGCACGGG + Intronic
1152851340 17:82638179-82638201 GAAGAGGGGAGGCGAGGGAAAGG + Intronic
1153614706 18:6923779-6923801 GAGCAGGGGCCGACTGGAAATGG + Intergenic
1153886927 18:9475549-9475571 GAGGCTGGGCGGGGTGGGAATGG + Intronic
1154960588 18:21304775-21304797 GAGGAGAGGGGGAATGGGAATGG + Intronic
1156326223 18:36077550-36077572 CAGTAGGGGCGGCCTGGCAGAGG + Intergenic
1158453586 18:57587585-57587607 GAAGAGGGGAGGCCGTGGAAGGG - Intergenic
1158936616 18:62370414-62370436 GGAGAGGGGCGGCCTATGAATGG - Intronic
1159011318 18:63061585-63061607 GAGAAGGGCCAGCCTGGGAAGGG - Intergenic
1160019281 18:75167823-75167845 GAGGAGGTGAGGACTGGGAGGGG - Intergenic
1160481214 18:79241290-79241312 GAGGAGGGGCAGCAAGAGAATGG - Intronic
1160499666 18:79395650-79395672 GAGGGGGGGCGCCCGGGGAGGGG - Intergenic
1160542162 18:79629809-79629831 GGGGACGGGAGGCGTGGGAAGGG + Intergenic
1160628289 18:80228302-80228324 GCGGAGGGGAGGCCAGGGGAGGG + Intronic
1160659453 19:291430-291452 GAGGAGGGGAGGGGCGGGAAGGG + Intronic
1160703503 19:518733-518755 GAGGAGGGGAGGCCGGGGATGGG + Intronic
1160714618 19:570646-570668 GCGGAGGGGCGGGTTGGGGAGGG + Intergenic
1160806231 19:993394-993416 CAGGTGGGGCGGCTAGGGAAAGG - Intronic
1160817603 19:1043324-1043346 GAGCAGGCGGGGCCTGGGATGGG - Exonic
1161074599 19:2279142-2279164 GAGGACAGGCGGAGTGGGAACGG + Intronic
1161088334 19:2345183-2345205 GAGCAGGGGCTTCCTGGGAGCGG - Intronic
1161108793 19:2456992-2457014 GCGGCGGGGCAGCCTGGGACTGG + Exonic
1161166870 19:2792453-2792475 GAGGGGGGGTGGGCTGGGCACGG - Intronic
1161213335 19:3079793-3079815 GAGGAGGGGAGGACGGGGAGGGG + Intergenic
1161257310 19:3316517-3316539 GAGGAGGAGAGGGCAGGGAAGGG + Intergenic
1161277466 19:3426669-3426691 GAGGAGGGGAGGACAGGGCAGGG - Intronic
1161331983 19:3692820-3692842 GAGGAGGGGAGGGCAGGGAGGGG - Intronic
1161401080 19:4066471-4066493 GAGGGGGCGCCGCCCGGGAAGGG - Intronic
1161482243 19:4516984-4517006 GGGGCGGGGCGGGCTGGGCAAGG - Intronic
1161488294 19:4547782-4547804 GAGGAGGGGAGGACGGGGAGGGG - Intronic
1161505786 19:4642742-4642764 GAGGAGGGGAGGGCAGGGAGGGG + Intronic
1161614603 19:5263052-5263074 GAGGAGGGGAGGGCGGGGGAGGG + Intronic
1161634230 19:5377202-5377224 GAGAAGGGGAGGGCAGGGAAGGG + Intergenic
1161846936 19:6717079-6717101 GAGGAGGGGAGGGCAGGGAAGGG + Intronic
1161999616 19:7734980-7735002 GAGGAGGTGATGCCTGGGGAAGG + Intergenic
1162367223 19:10256855-10256877 GGGGTGGGGGGGCCAGGGAAGGG + Intronic
1162413181 19:10518540-10518562 GAGGAGCAGTGGCCTGGGAGAGG - Intergenic
1162621696 19:11848961-11848983 GGGGAGGGGCTGCCTGGAACTGG + Intronic
1162630755 19:11925305-11925327 GGGGAGGGGCTGCCTGGAACAGG + Intronic
1162672116 19:12266219-12266241 GAGGAGGGGCTGGCTGGGACCGG - Intronic
1162783250 19:13018282-13018304 CAGGAGCGGTGGCCTGGGATCGG - Intronic
1162959932 19:14119631-14119653 GAGGGGGAGCGGGCTGGGGAGGG + Exonic
1163370096 19:16896945-16896967 GAGGAGGCGCGGCAGGGGACGGG - Intronic
1163468727 19:17484829-17484851 GATCTGGGGAGGCCTGGGAAAGG + Intronic
1163476026 19:17526769-17526791 GAGGATGGGTGGCCTGGCAGGGG - Intronic
1163480842 19:17555510-17555532 GGGGCGGGGCGTCCTGGGTAGGG + Intergenic
1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG + Intronic
1163700700 19:18785294-18785316 GAGGAGGGGCGGGCTCGGGAAGG - Intronic
1163715605 19:18870497-18870519 GTGGAGGGGCGGCCAAGGACGGG + Exonic
1163758427 19:19120409-19120431 CAGGAGGCGGGGCCTGGGGAGGG - Intronic
1163758465 19:19120528-19120550 CAGGAGGCGGGGCCTGGGTAGGG - Intronic
1163771113 19:19192016-19192038 GTGGAGGGGCGGCCTGACAAAGG - Intronic
1163773575 19:19205170-19205192 GAGGAAGGGCTTCCTGGGAAAGG + Intergenic
1164016623 19:21260374-21260396 GATGAAGGGCGGCCGGGGAGAGG + Intronic
1165094351 19:33402350-33402372 GAGGAGGAGGGGGCTGGGCAGGG + Intronic
1165462689 19:35953349-35953371 GAAGAGGGATGGCGTGGGAAGGG - Intergenic
1165635073 19:37333896-37333918 GAGGTGGGGCGGTGTTGGAAAGG - Intronic
1165759366 19:38311640-38311662 GATGAGGGGTGGGCAGGGAAGGG + Intronic
1166084836 19:40467554-40467576 AGAGAGGCGCGGCCTGGGAAGGG + Intronic
1166106704 19:40601270-40601292 GAGGAGGGGGGGCCTGAGCGGGG + Intronic
1166445817 19:42856605-42856627 CAGGAGGGGGAGCCTGGGACAGG + Intronic
1166447303 19:42869317-42869339 GATTAGGGAGGGCCTGGGAAGGG - Intronic
1166683736 19:44782647-44782669 GAGAAGAGGCGGGCTGGGAGGGG - Intronic
1166690359 19:44818731-44818753 GGGGAGTGGAGTCCTGGGAAGGG - Exonic
1166753340 19:45175693-45175715 GAGGAGGGGCCACGTGAGAAAGG + Intronic
1166766200 19:45252980-45253002 GGGCAGGGGGCGCCTGGGAATGG - Intronic
1166862409 19:45817932-45817954 GAGGCGGGGTGGCCGGGGATGGG + Intronic
1167134939 19:47610235-47610257 GACGAGGGGCAGCCAGGGATGGG - Intronic
1167251418 19:48400232-48400254 TAGGAGGTGGGGCCTGAGAAGGG + Intronic
1167459781 19:49618764-49618786 GAGCTGGGCAGGCCTGGGAAAGG - Intronic
1167528347 19:49999633-49999655 GAAGAGGGGTGGGCTGGGAGGGG - Intronic
1167596682 19:50432013-50432035 GAGGGGGCGGGGCCTGGGGAGGG - Intergenic
1167665494 19:50820976-50820998 GAGGAGGGGAGGCCTGAGAGCGG + Intronic
1167843242 19:52139330-52139352 GTGAAGGGGCAGCCTGGGGAGGG + Intronic
1167960952 19:53103618-53103640 GGGGAGGAGCCGCCGGGGAAGGG + Intergenic
1168063976 19:53909247-53909269 GGGGAGGGGCGGGGAGGGAAGGG - Intergenic
1168301157 19:55405942-55405964 GAGGAGAGCCGGCCTGGCAGGGG - Intronic
1168452711 19:56478223-56478245 GAGGAGGGGCGGACAGCGGAAGG + Intergenic
1168708378 19:58482589-58482611 CAGGAGGGGCTCCCTGGGAGGGG + Intronic
924966702 2:83199-83221 CAGGAAGGGGGGCATGGGAAGGG - Intergenic
925039164 2:716816-716838 GAGGAGGGGAGGCCTTGGGGTGG + Intergenic
925068944 2:951126-951148 GAGGAGGGGCGGGGGGAGAAGGG - Intronic
925917496 2:8617187-8617209 CAGGAGGGGCGGCCGGGGGGCGG + Intergenic
926801712 2:16665489-16665511 GAGGGAGGGTGGTCTGGGAAAGG + Intronic
926929979 2:18027525-18027547 GAGGGGGTGGGGCATGGGAAGGG - Intronic
926972047 2:18475937-18475959 GAGGAGGGAAGGCGGGGGAAGGG + Intergenic
927095861 2:19747156-19747178 GAGGAAGGGCTGCGAGGGAAGGG - Intergenic
927485646 2:23486790-23486812 GAGGAGGTGTGGCCTGAGCAGGG - Intronic
927678056 2:25121444-25121466 CAGCAGGGGAGGCCTGAGAAGGG + Intronic
928086115 2:28347434-28347456 GAGGAGGGGCCAGCTGGGCATGG + Intergenic
928264759 2:29802326-29802348 GAGGAGGGGAGGGCAGGGGAGGG + Intronic
928339732 2:30432144-30432166 GATCAGGGGTTGCCTGGGAATGG - Intergenic
928424381 2:31166045-31166067 GAGGAGGAGCAGCATGGGAAAGG - Intergenic
928674272 2:33635126-33635148 GAGGTGGGGCTGGCTGGGCATGG - Intergenic
929437726 2:41940938-41940960 GAGGAGGGGAGGCCGTGGGAGGG + Intronic
929526365 2:42706972-42706994 GAGGAGGAGGGGGCTGGGGAGGG - Intronic
929602470 2:43212983-43213005 GAGGAGTGGTGGCCTGGAAGAGG + Intergenic
929819177 2:45259674-45259696 GAGGAGAAGCGGTCTGGGACAGG + Intergenic
930700696 2:54456330-54456352 GAGGAGAGGCGGCCGAGGGAGGG - Exonic
931060257 2:58520836-58520858 GAGGAGGGGTGGGTTGGGGAAGG + Intergenic
931191325 2:60003074-60003096 GACGAGAGGAGGCATGGGAAGGG + Intergenic
931766231 2:65459049-65459071 GAGGAGGGGAGGCTGGGAAAGGG - Intergenic
932038058 2:68268604-68268626 GAGGATGGGAGGGTTGGGAAGGG + Intergenic
932347487 2:71005156-71005178 GAGGAAGGGCAGGCTGGGCAGGG - Intergenic
932467879 2:71935061-71935083 GAGGAGGGGCAGGTTGGGGATGG + Intergenic
932566805 2:72916063-72916085 GGGGAGGGGCGGCCAGGGGTGGG - Intergenic
932699275 2:73982315-73982337 GAGAAGGGGTGGGGTGGGAAGGG + Intergenic
934188722 2:89766737-89766759 GGGCAGGGGCAGCCTGGGAGGGG - Intergenic
934307872 2:91841216-91841238 GGGCAGGGGCAGCCTGGGAGGGG + Intergenic
934477177 2:94601582-94601604 GAGGAGGGGGTGCGAGGGAAGGG + Intronic
934564103 2:95328963-95328985 GAGGAGGGGAGGGCAGAGAATGG + Intronic
935275720 2:101474147-101474169 GAGGAGGTGGGGCCGGGGAGGGG - Intronic
935347421 2:102121422-102121444 GTGGAGGAGCAGCCTGGAAATGG - Intronic
935570086 2:104650359-104650381 CAGGAGGGGAGGCGAGGGAAGGG + Intergenic
936447481 2:112607287-112607309 GGGAAGGGGAGGCCAGGGAAGGG - Intergenic
936580380 2:113695127-113695149 AGGGAGGGGCGGGCAGGGAAAGG + Intergenic
936800179 2:116257137-116257159 GGGGAGGGGCCTCCTGGGAGGGG - Intergenic
937027603 2:118712286-118712308 GAGGAGGGGAGGGGAGGGAAGGG + Intergenic
937193543 2:120129031-120129053 AAGGAGGGATGGACTGGGAAAGG + Intronic
937246330 2:120496467-120496489 GAGGGTGGGCTGGCTGGGAAAGG + Intergenic
937867784 2:126767037-126767059 GAGGAGTAGCGGGCTGGGGAAGG - Intergenic
937957800 2:127431679-127431701 TAGGTGGGGCTGCCTGGAAATGG + Intergenic
937987302 2:127643858-127643880 GGGGCTGGGGGGCCTGGGAAGGG - Intronic
938035100 2:128028420-128028442 GGGGAGGCGCGGCGCGGGAAAGG + Intergenic
938637973 2:133249801-133249823 AAGGTGGGGCGGTTTGGGAAGGG + Intronic
938957700 2:136314596-136314618 GAGGAGGGGAGGGAAGGGAAGGG - Intergenic
938957747 2:136314701-136314723 GAGGAGGGGAGGGGAGGGAAGGG - Intergenic
940849074 2:158671376-158671398 GGGGTGGGGAGGGCTGGGAAGGG + Intronic
942316223 2:174698891-174698913 AAGGAGGGGCGGGCTGGGGTGGG - Intergenic
942414199 2:175741252-175741274 GAGGAGGGGAGGGGAGGGAAGGG + Intergenic
943064364 2:183071004-183071026 CAGGAGGGGCAGGCTGGGAGGGG + Intergenic
944445539 2:199784734-199784756 GAGGAAGTGTGGCCTGGGTAAGG + Intronic
944933712 2:204545786-204545808 GGGGAGGGGCGGCCGCGGAAAGG - Intronic
945305456 2:208255116-208255138 GAGGAGGCGGGGCCTGGGAGGGG - Intronic
946192729 2:218016034-218016056 GAGGAAGGAGGGCCAGGGAAAGG + Intergenic
946386843 2:219388481-219388503 GCGGAGGCGCGGCCTGGAGAGGG - Intronic
946446909 2:219747911-219747933 GGGGAGGGGAGGGCAGGGAAAGG - Intergenic
946524636 2:220505216-220505238 GAGAAGGGGCAGTCGGGGAAAGG + Intergenic
946589823 2:221232891-221232913 GAGGAGGGGAGGGAAGGGAAGGG + Intergenic
946622432 2:221573549-221573571 GAGGAGGGGCGGCCTGGGAAGGG - Intronic
946809845 2:223512204-223512226 GAGGAGTGGAGGGCTGAGAAAGG - Intergenic
948123960 2:235551189-235551211 GAGGTGGGGCCACCCGGGAAAGG + Intronic
948289916 2:236817253-236817275 AAGGAGGGAGGGCCAGGGAAGGG - Intergenic
948414316 2:237791222-237791244 GAGGAGGAGAGGCCAGGAAAGGG + Intronic
948467228 2:238158401-238158423 GACGGAGGGCGGCCTGGAAAGGG + Intergenic
948656799 2:239481287-239481309 GAAGAGGGGCTGCCGGGGCAGGG - Intergenic
948857673 2:240737599-240737621 GAGGAGGGGAGGGATGGGAAGGG + Intronic
948880150 2:240852521-240852543 GAGGAGAGGCGGCCGCGGCAGGG - Intergenic
948886260 2:240886530-240886552 GAGGTGGGGATGCCTGGGGAAGG + Intronic
949014658 2:241702408-241702430 GATGAGGCGGGGCCTGGGTAGGG - Intronic
1168765839 20:381217-381239 GGGAGGGGGCGGCCGGGGAAGGG + Intronic
1168799593 20:635587-635609 CAGGAGGGCAGGCCTGGGGAAGG - Intergenic
1169194229 20:3674737-3674759 GAGGAGGCTGGGCCTGGGATGGG - Intronic
1169305739 20:4488846-4488868 GAGTAGAGGCAGCCTGGGATAGG + Intergenic
1169419574 20:5449112-5449134 GAGGAGGGGAGGACAGGGCATGG + Intergenic
1169725259 20:8721902-8721924 GAAGAGTCGCGGCTTGGGAAAGG + Intronic
1169730038 20:8776882-8776904 AAGGAGGGGCGGTTTGGGGAAGG + Intronic
1169758795 20:9068931-9068953 GAGGCGGGGAGGCCAGGGAGGGG + Intronic
1170035116 20:11981653-11981675 GAGGAGGGGAGGGGAGGGAAAGG - Intergenic
1170197395 20:13703422-13703444 GACGATGGGCGGCCTGGCAGAGG - Intergenic
1170632979 20:18080977-18080999 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1170688341 20:18588679-18588701 GGCGAGGGGCGTCCTGGGCAGGG - Intronic
1171428564 20:25064150-25064172 CAGGAGAGGCAGCTTGGGAATGG - Intergenic
1172128348 20:32638840-32638862 CAGGAGGAGGGGCCTGGGACAGG - Intergenic
1172423947 20:34842318-34842340 GAGGAGGGGAGGAGAGGGAAGGG + Intergenic
1172907321 20:38379108-38379130 CAGTAGGGGCGGCCAGGCAAAGG - Intergenic
1173201945 20:40960951-40960973 GAGGAGCGGGGGCCAGGGAAGGG + Intergenic
1174061384 20:47835470-47835492 GAGGATGGGGAGCCGGGGAAAGG - Intergenic
1174070143 20:47893853-47893875 GAGGATGGGGAGCCGGGGAAAGG + Intergenic
1174156253 20:48517374-48517396 GAGGATGGGGAGCCGGGGAAAGG - Intergenic
1174358145 20:50011731-50011753 GAGGAGGGGAGGGGAGGGAAGGG + Intergenic
1174869294 20:54168428-54168450 GAGGAAGGGGAGCCTGTGAAAGG - Intronic
1175100578 20:56576091-56576113 AGGGAGGGGCTGGCTGGGAAGGG - Intergenic
1175892302 20:62321224-62321246 GAGGAGGCGGGGCCTGTGGAGGG + Intronic
1176123698 20:63465703-63465725 GAGGAAGCGCGTCCTGGGTAGGG - Intronic
1176213202 20:63935594-63935616 TCTGAAGGGCGGCCTGGGAAGGG + Exonic
1176520643 21:7821649-7821671 GAGGAAGAGGGGCCTCGGAAAGG - Intronic
1176549261 21:8214439-8214461 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
1176557154 21:8258662-8258684 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
1176568193 21:8397477-8397499 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
1176576096 21:8441697-8441719 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
1177316366 21:19466978-19467000 GATCAGTGGCTGCCTGGGAATGG + Intergenic
1177905472 21:26967207-26967229 GATTAGGCGCGGACTGGGAAGGG - Intergenic
1178129463 21:29555206-29555228 GAGAAGTGGTGGCGTGGGAATGG - Exonic
1178293030 21:31386104-31386126 GTGGAGGGGCTGCCAGGGACAGG + Intronic
1178654666 21:34451661-34451683 GAGGAAGAGGGGCCTCGGAAAGG - Intergenic
1178878294 21:36429268-36429290 AAGGGACGGCGGCCTGGGAAGGG + Intergenic
1178917053 21:36710838-36710860 GAGCAGAGGCCGCCTGGGCAGGG - Intronic
1179009685 21:37546652-37546674 AAGGAGGGGCGTTGTGGGAATGG + Intergenic
1179267391 21:39816432-39816454 GAGGAGGGGAGGGGAGGGAAGGG + Intergenic
1179610079 21:42544666-42544688 GAGCAGGGGCCTCCTGGGATGGG + Intronic
1180048951 21:45322745-45322767 GAGGAGGGCGGGGCTGGGACAGG - Intergenic
1180194141 21:46183369-46183391 GAGGAGGGAGGGACTGGCAAGGG + Exonic
1180568824 22:16697432-16697454 GAGGAGGGGCGTCAGGGGCAAGG + Intergenic
1181111978 22:20607570-20607592 GAGGAGTCAGGGCCTGGGAAGGG + Intergenic
1181528750 22:23504123-23504145 GAGATGGGCTGGCCTGGGAAGGG - Intergenic
1181934068 22:26427481-26427503 GAGGAGGTGGGTCCTGGGACAGG + Intergenic
1181934111 22:26427619-26427641 GAGGAGGTGGGTCCTGGGACAGG + Intergenic
1181934154 22:26427757-26427779 GAGGAGGTGGGTCCTGGGACAGG + Intergenic
1181934234 22:26428056-26428078 GAGGAGGTGGGTCCTGGGACAGG + Intergenic
1182000097 22:26913209-26913231 GAAGAGGGGCGCCCTAGGGAAGG - Intergenic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182501594 22:30752037-30752059 GAGGAAGGGCTGGCAGGGAAGGG - Intronic
1182592126 22:31389503-31389525 GGGGAGGGGAGGCAAGGGAAGGG - Intergenic
1182667554 22:31970711-31970733 GAGGAGCGGCGTCCCGGGAAAGG + Intergenic
1182686859 22:32127998-32128020 AAGGAGGGGAGGGCTGGGAGTGG - Intergenic
1182697702 22:32207564-32207586 GTGGAGGCGCAGCCTGGGGAAGG + Intergenic
1182959951 22:34462791-34462813 GAGGAGGTGTGGCCTGGAAGGGG - Intergenic
1183177172 22:36232807-36232829 GAGGAGGGGAGGGGTGGGAGAGG - Intronic
1183180663 22:36257733-36257755 GAGGAGAGGAGGGCTGGGAGAGG + Intronic
1183360144 22:37379073-37379095 GAGGAGGTGAGGACTGAGAATGG + Intronic
1183453015 22:37906732-37906754 GGGGAGGGGCGCCCTGGGCCGGG - Intronic
1183953758 22:41367357-41367379 GTGGACGGGCGGGCTGGGACTGG + Intronic
1183967686 22:41452521-41452543 GAAGAGGGGCTGCTTGGGGATGG - Intergenic
1184059396 22:42073093-42073115 GAGGCTGGGAGGCCTGGGGAGGG - Intergenic
1184094069 22:42307069-42307091 GAGGAGGGGCAGCCAGGGCCGGG + Intronic
1184210870 22:43034921-43034943 GGGGAGGGGAGGGGTGGGAAGGG + Intergenic
1185065358 22:48629275-48629297 GAGGATGGGAGGCCTGGGAGAGG - Intronic
1185382847 22:50518078-50518100 GAGGGAGGCCTGCCTGGGAAGGG + Intronic
1203254146 22_KI270733v1_random:130755-130777 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
1203262202 22_KI270733v1_random:175834-175856 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
949459545 3:4275489-4275511 GAGGTGGGGAGTTCTGGGAAAGG - Intronic
950078583 3:10205294-10205316 GAGGAGGGGAGGGCTGGGTAGGG + Intronic
950455384 3:13089751-13089773 GATGAGTGGCTGCCAGGGAATGG + Intergenic
950648691 3:14393724-14393746 GAGCTGGGGCAGCCTGAGAACGG + Intergenic
951017437 3:17745825-17745847 GAGGGGGAGCGGTCGGGGAAAGG - Intronic
952884206 3:38002784-38002806 GAGGGGAGGCGGCCTGGGCCTGG - Intronic
952958443 3:38575231-38575253 GAGGAGGGGAGGGCAGGGAAAGG - Intronic
953030688 3:39177944-39177966 GGGGAGGCGCGGGGTGGGAAGGG + Intergenic
954159479 3:48710565-48710587 GGGCAGGTGAGGCCTGGGAAAGG - Intronic
954443763 3:50535755-50535777 GAGCAGGGGTGGGCTGGGCAGGG - Intergenic
954711726 3:52508203-52508225 GAGCAGAGGCAGCCTGGGCAGGG + Intronic
954796163 3:53162139-53162161 GCGGAGGGGTGGGGTGGGAAGGG - Intronic
954948379 3:54446799-54446821 AGGGAGGGGAGGCCAGGGAAGGG - Intronic
956436255 3:69237218-69237240 GAGGAGGGAGGGGCCGGGAAAGG + Intronic
957529953 3:81428376-81428398 GAGAGGGGGCAGACTGGGAACGG - Intergenic
957966250 3:87324737-87324759 CAGGATGGGTAGCCTGGGAAGGG - Intergenic
959186836 3:103055815-103055837 GAGGAAGGGGGGCCTAGGAGAGG + Intergenic
960943939 3:122953244-122953266 GAGGCAGAGAGGCCTGGGAAGGG - Intronic
961322164 3:126083839-126083861 TCGGAGGGGCGGCCTGGGGCGGG - Intronic
961357438 3:126347977-126347999 GAAGAGACGCGGCCTGGGAGTGG + Intronic
961666828 3:128497922-128497944 GGGGAGGGGCGGCCGGGGAGTGG - Intergenic
961669991 3:128522087-128522109 GAGGAGAGGCTTCCTGAGAATGG + Intergenic
961676292 3:128568970-128568992 GGGCAGGGGCGGCCTGGGAATGG + Intergenic
961810997 3:129521587-129521609 GAGGAGGGGCGGTCTGGGGTGGG - Intergenic
961831712 3:129626507-129626529 GGGGAGGGACTGACTGGGAAGGG + Intergenic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962596462 3:136950740-136950762 TAGGAGGAGAGTCCTGGGAAGGG + Intronic
962712743 3:138101442-138101464 CAGGAGGGGCAGGCTGGGAGGGG + Intronic
963084750 3:141426518-141426540 GAGGAGAGGAGGCCGGGGGAGGG + Intronic
963850677 3:150207505-150207527 GAGGAGGAGCGGGAAGGGAATGG - Intergenic
964623370 3:158736425-158736447 GAGGAGGGGAAGGGTGGGAATGG + Intronic
965530384 3:169765033-169765055 GCGGAGGGTGGGCCTGGGAGGGG - Intergenic
966402648 3:179563177-179563199 GGGGAGGGGAGGGCTGGGAGCGG - Intronic
966473942 3:180322903-180322925 GAGGCTGGGCGGGGTGGGAATGG + Intergenic
966903484 3:184504935-184504957 GAGGAAGGGAGGTATGGGAATGG - Intronic
967177689 3:186874492-186874514 CAGTAGGGGCGGCCGGGGAGAGG - Intergenic
967184092 3:186930676-186930698 GGGGAGGGGAGTCCTGGGCAGGG + Exonic
967394286 3:188989921-188989943 GAAGATATGCGGCCTGGGAATGG - Intronic
968287880 3:197518837-197518859 GAGGGGGGTCGGCCTGAGGAGGG - Intronic
968534100 4:1113013-1113035 GAGGAGGGGCCACCGGGGAGTGG - Intronic
968622055 4:1608277-1608299 CAGGAGGGGCCGCCTGGGGTGGG - Intergenic
968882561 4:3309011-3309033 GAGGAGCTGGGACCTGGGAATGG + Intronic
968882695 4:3309542-3309564 GAGGAGCTGGGGCCTGGGAATGG + Intronic
968882707 4:3309595-3309617 GAGGAGCTGGGACCTGGGAATGG + Intronic
968882740 4:3309701-3309723 GAGGAGCTGGGACCTGGGAATGG + Intronic
968882855 4:3310124-3310146 GAGGAGCTGGGGCCTGGGAATGG + Intronic
968902419 4:3437943-3437965 GAGGAGGGGCACGCTGGGATTGG + Intronic
968912067 4:3481421-3481443 GAGGAGGGCCGGCCCGGGAAGGG + Intronic
968938165 4:3624404-3624426 GGGGAGGGGCAGCCTGGGAGGGG + Intergenic
968938184 4:3624457-3624479 GGGGAGGGGCAGCCTGGGAGGGG + Intergenic
968938261 4:3624716-3624738 GGGGAGGAGCAGCCTGGGATGGG + Intergenic
969134541 4:5019641-5019663 GAGGAGGGGCTGCCTGGAGGAGG + Intergenic
969399972 4:6948041-6948063 GAGGAGGGACTGCGTGGGGAGGG + Intronic
969444356 4:7235591-7235613 GAGGGGTGGCTTCCTGGGAAGGG + Intronic
969672087 4:8595440-8595462 GGGCAGGTGCGGCCTGGGAGAGG + Intronic
969689116 4:8694583-8694605 GAGGAGGAGCAGCCGGGGAGTGG + Intergenic
970772909 4:19637994-19638016 GGGGAGGGGAGGCGAGGGAAGGG - Intergenic
971424814 4:26505175-26505197 GAGGCGGGGCGGCATGAGAGGGG + Intergenic
971425163 4:26508758-26508780 GATGATGGGAAGCCTGGGAAAGG - Intergenic
972557213 4:40193511-40193533 GAGGAGGGGCGGGGTGGGGGAGG + Intronic
972579903 4:40385951-40385973 GGGGAGGGGAGGCCAGGGGAGGG + Intergenic
975468484 4:74736488-74736510 GAGGAGGAGCTGACTGGGAGTGG - Intergenic
976307862 4:83579251-83579273 GGGGAGGGGCGGGAAGGGAAGGG - Intronic
976660236 4:87533133-87533155 TAGAAGGGCTGGCCTGGGAAAGG - Intergenic
977928599 4:102728710-102728732 CAGGAGGGGCAGGCTGGGAGGGG + Intronic
978443964 4:108763100-108763122 GAGGAGGAGGGGCTTGGCAAAGG - Intergenic
979795368 4:124839668-124839690 GAGGAAGGGAGGGATGGGAAGGG - Intergenic
982117271 4:152108006-152108028 GAGGAGGGCTGGGCTGGGTAAGG + Intergenic
982161145 4:152570690-152570712 GAGGAGGGACAGCCTGGGGCAGG + Intergenic
983899949 4:173122906-173122928 CAGGAAGGGCTGCCTGGGAAGGG + Intergenic
984402063 4:179279004-179279026 GAGGAGAGGAGGCAAGGGAAGGG - Intergenic
985705744 5:1400521-1400543 CAGGAGGGGAGGCCTGGGCCTGG - Intronic
985748735 5:1662291-1662313 GAGGAGGGACGCCTTTGGAAGGG - Intergenic
985872779 5:2570454-2570476 GTGGAGGTGGGGCCTGGGAAGGG - Intergenic
986100888 5:4610002-4610024 GATGAGGGGCAGCCTGTGCAAGG - Intergenic
986340563 5:6785419-6785441 GAGGATGGGCTCCCTGGGGAGGG + Intergenic
988264458 5:28929638-28929660 GAGGATGGGCGGCCGGGCACAGG + Intergenic
990021101 5:51128451-51128473 GAGCAGGGGGGGCCTGGGCCGGG - Intergenic
990165490 5:52989273-52989295 CAGGAGGGGCGGGCTGGGGCGGG + Intergenic
990709136 5:58563375-58563397 GATGATGGGCGGCCTGGCAGAGG + Intergenic
992527924 5:77630022-77630044 GAAGAGGGGCGGCCGGGAGACGG + Exonic
992574867 5:78097708-78097730 CAGTAGGGGCGGCCTGGCAGAGG - Intronic
994050752 5:95359489-95359511 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
994678794 5:102860162-102860184 GAGGAAGGGTGGCCTGGCATGGG + Intronic
995724602 5:115170010-115170032 GAGGCGGGGCCGCCTGGGGCTGG + Intronic
995853705 5:116572935-116572957 GCGGAGGGGCGGCGAGGGAGCGG + Intronic
996598294 5:125230505-125230527 GGGGAGGGAGGGACTGGGAAAGG - Intergenic
997464008 5:134074634-134074656 GAGGAGAAGAGGCCTGGGAAGGG - Intergenic
997471665 5:134120690-134120712 GAGGAGGGTCCTACTGGGAATGG - Intronic
998849327 5:146338770-146338792 GGGGCGGGGCGGACTGGGAGAGG + Intronic
998887114 5:146706171-146706193 TAGGAGGGGCAGGCTGGGAGGGG + Intronic
999763576 5:154721516-154721538 GTGTAGGGGAGGCCAGGGAAAGG + Intronic
999809599 5:155115067-155115089 GAGGAGGGGAGGCTTGGGCATGG - Intergenic
1000064568 5:157683564-157683586 GAGGAGGGGAGGGGAGGGAAGGG - Intergenic
1000093664 5:157951933-157951955 GAGGAGGGGAGGGGAGGGAAAGG - Intergenic
1000863578 5:166485653-166485675 CAGGAGGGGACACCTGGGAAAGG + Intergenic
1001396122 5:171420503-171420525 GAGGGGGCGCGGCCGGGGAAGGG - Intronic
1001402907 5:171456644-171456666 AAGAAGGGGCGGCCGCGGAAGGG + Exonic
1001602687 5:172939367-172939389 GAGGAGGAAGGGCCCGGGAAAGG + Intronic
1001963840 5:175896380-175896402 GGGGAGGGGAGGGCTGGGGAAGG - Intergenic
1001991041 5:176115518-176115540 GAGGAGGGGCTCCCTGGGATGGG - Intronic
1002199216 5:177517627-177517649 GAGGAGAGGCGTCCTGGGCCAGG + Intergenic
1002199310 5:177518350-177518372 GAGGAGAGGCGTCCTGGGCCAGG + Intergenic
1002225831 5:177722622-177722644 GAGGAGGGGCTCCCTGGGATGGG + Intronic
1002268018 5:178048590-178048612 GAGGAGGGGCTCCCTGGGATGGG - Intronic
1002405074 5:179024049-179024071 GAGGGGGCGTGGCCTGGGAAGGG + Intronic
1003319385 6:5037877-5037899 CAGTAGGGGCGGCCGGGCAAAGG + Intergenic
1003868713 6:10385106-10385128 GAGGGGGCGCGGGCTGGGAGGGG - Intergenic
1004414929 6:15415756-15415778 CAGTAGGGGCGGCCTGGCAGAGG + Intronic
1005310678 6:24556163-24556185 GAGGAGGGGAGGGGAGGGAAGGG - Intronic
1005521487 6:26604735-26604757 GAGGAGGTGCTCCCTGGGATTGG + Intergenic
1005677001 6:28165021-28165043 GAAGAGGGGAGGGGTGGGAAAGG - Intergenic
1005861989 6:29908732-29908754 TAGGAGTGGGGGCCTGGGTAGGG - Intergenic
1006027788 6:31158361-31158383 GAGGAGGAGCCGCCTGGGCGCGG - Intergenic
1006210328 6:32388006-32388028 GAGGAGGGGAGGCGTTTGAAGGG + Intergenic
1006336920 6:33425746-33425768 GGGGAGGGGCGGCGTGGGCCAGG + Intronic
1006340959 6:33446786-33446808 GGTGAGGGGCGGCCTGGGGAGGG + Exonic
1006457964 6:34142831-34142853 GAGGAGGAGCGGCCTACGCAAGG + Intronic
1006500024 6:34452404-34452426 GAGGAGGGGAGGCCTCGGGAGGG + Intergenic
1006847402 6:37072188-37072210 GAGGAGGGGCAGCCTTCGATGGG + Intergenic
1007228821 6:40334001-40334023 GAGATGGGGCAGCCAGGGAAAGG - Intergenic
1007340413 6:41187820-41187842 GAGGTGGGGTGTCCTGGGAGGGG + Intergenic
1007373467 6:41441841-41441863 GAGGAGGGGCAGTATGGGAAGGG + Intergenic
1007775646 6:44223162-44223184 GAGGAAGCGCGGCGTGGGCAGGG + Intronic
1008313929 6:50015435-50015457 GAGGAGGTGAGTCCTGGGAGAGG - Intronic
1008497981 6:52152249-52152271 GAGGAGGGGAGGAGAGGGAAGGG + Intergenic
1008764129 6:54890639-54890661 GATGAGGGGAGGGCAGGGAATGG - Intronic
1009622612 6:66096708-66096730 CAGAAGGGGCGGCCTGGAAGAGG + Intergenic
1011426684 6:87239244-87239266 CAGAAGGGGCGGCCGGGCAAAGG + Intronic
1012137514 6:95577532-95577554 GAGGAGGGGCTGTCTGGGCTCGG + Exonic
1012337341 6:98077150-98077172 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1012450687 6:99349940-99349962 GCGGAGGGCCGGCCGGGGTAGGG - Intronic
1012472751 6:99589556-99589578 GAGGACGGGCAGGCTGGCAAAGG - Intergenic
1013273154 6:108560774-108560796 GGGGAGGGGCGCCCGGGGGAGGG - Intronic
1013341677 6:109221515-109221537 GAGGAGGGGAGGGGTGGGGAGGG - Intergenic
1016940046 6:149475788-149475810 GTTGGGGGGTGGCCTGGGAAGGG + Intronic
1017009908 6:150056395-150056417 GAGGATGGGGAGCCGGGGAAAGG - Intergenic
1017626671 6:156356388-156356410 CAGGAGGGGCTGCCTGGAAGAGG + Intergenic
1017809849 6:157976965-157976987 GAAGAGGGGCGACCTGGGCAGGG - Intergenic
1018839533 6:167508110-167508132 GAGGAGAGGTGGCAGGGGAAGGG - Intergenic
1019179417 6:170177274-170177296 GGGGAGGGGCGGCCTGTGGGGGG + Intergenic
1019273762 7:165060-165082 GAGGAGGCCCGGCCTGGACATGG - Intergenic
1019385793 7:755355-755377 GAGGAGGAGAGGCCTGAGCATGG - Intronic
1019477137 7:1249538-1249560 GAGGTGGGGCGGGTTGGGGAGGG - Intergenic
1019570872 7:1711414-1711436 GAGGAGGGGAGGGGAGGGAAGGG + Intronic
1019600674 7:1882132-1882154 GAGGAGGGGCAGCCTTGGGAGGG + Intronic
1019703775 7:2487895-2487917 GGGGAGGGTGGGCCTGGAAATGG + Intergenic
1019904238 7:4048595-4048617 GAGGAAGGGTGGCCTGTGAGGGG - Intronic
1019930490 7:4219795-4219817 GAGGAGCGGGGGCGGGGGAAGGG - Intronic
1020111235 7:5448834-5448856 GAGGAGGGGAAGGCTGGGGAGGG + Intronic
1020133902 7:5575206-5575228 GAGGTGTCTCGGCCTGGGAAAGG - Intergenic
1020357440 7:7292806-7292828 TAGGAGGGACGGGTTGGGAAGGG - Intergenic
1022544730 7:31175449-31175471 GAGATGGGGAGGCCTGGGGAGGG - Intergenic
1022776153 7:33529592-33529614 GAGGAGGGGAGGGAAGGGAAGGG - Intronic
1023062721 7:36343542-36343564 GAGGAGGGGAGGGAAGGGAAGGG + Intronic
1023289725 7:38656627-38656649 CAGGAGGGGCAGGCTGGGAGGGG - Intergenic
1023766913 7:43520399-43520421 GAGGAGGAGCTGCCCGGGAGAGG - Intronic
1023858540 7:44201417-44201439 GAGGCGGGGCGGGGTGGGGAGGG + Intronic
1023864580 7:44232698-44232720 GGGGAGGGGCGGCCAGGGCATGG + Intronic
1024141170 7:46464769-46464791 GAGGAGGAGCTGCCTGTTAAAGG + Intergenic
1025231693 7:57207057-57207079 GAGGAGGGGAGGGCAGGGAAGGG - Intergenic
1025233044 7:57215601-57215623 GAGGATGGGGAGCCGGGGAATGG + Intergenic
1025610467 7:63072380-63072402 GAGGAGGGGAGGGCTGGGGGAGG - Intergenic
1026015788 7:66669733-66669755 CAGGAGGGGCAGGCTGGGGAAGG - Intronic
1026468436 7:70674175-70674197 GGGGAGGGGGGCCCTGAGAAAGG + Intronic
1026470929 7:70693953-70693975 GAGGAGGGGCGGCGAGGGGCGGG + Intronic
1026834854 7:73631866-73631888 GTGGAGGGGAGGGCAGGGAAGGG - Intergenic
1026873981 7:73869478-73869500 GAGGCGGGGGGGTCAGGGAAGGG - Intergenic
1026966559 7:74443896-74443918 CAGGAGGGGCTGAGTGGGAAGGG - Intergenic
1027050129 7:75016568-75016590 GTGGAGGGGAGGCCAGGAAAAGG - Intronic
1028328619 7:89559703-89559725 GAGGAGGGGAGGGGTGGGGAGGG + Intergenic
1028510560 7:91620898-91620920 GAAGAGGGGGCACCTGGGAAGGG - Intergenic
1029361166 7:100089394-100089416 CAGGAGGGGCGGCCTGTGCAGGG + Exonic
1029382906 7:100225100-100225122 GTGGAGGGGAGGCCAGGAAAAGG + Intronic
1029444196 7:100603737-100603759 GAGGAGGGAGGGCCGGGGACTGG - Intronic
1029477705 7:100794858-100794880 GAGGAGGGGAGGGCAGGGGAGGG + Intronic
1029594269 7:101528510-101528532 GAGGAGGGGAGGAGAGGGAAGGG - Intronic
1029646199 7:101857658-101857680 GAGGGGTGACGGCCTGGCAAAGG - Intronic
1030617857 7:111757058-111757080 CAGGAGGAGCGGCTTGCGAAAGG + Intronic
1030927772 7:115479127-115479149 GAGGAGGGGAGGGGAGGGAAGGG - Intergenic
1032018119 7:128392583-128392605 GAGGGGCAGCGGCCCGGGAAGGG + Exonic
1032473863 7:132199176-132199198 GAGGAGGAGGGGGCTGGGAGTGG - Intronic
1033376063 7:140763172-140763194 CAGTAGGGGCGGCCGGGGAGAGG + Intronic
1033954885 7:146834505-146834527 GAGGATGGGAGGGGTGGGAAAGG + Intronic
1034227981 7:149497646-149497668 GAGGAGCGGCGGCAGAGGAAAGG - Exonic
1034299218 7:150000760-150000782 CAGGAGCTGCGGGCTGGGAAGGG - Intergenic
1034345221 7:150381772-150381794 GAGGAGGGGAGCCAAGGGAAAGG - Intronic
1034561110 7:151879736-151879758 GAAGACGGGGTGCCTGGGAAGGG + Intergenic
1034806797 7:154096013-154096035 CAGGAGCTGCGGGCTGGGAAGGG + Intronic
1035574775 8:697518-697540 GAGGAGGGGTCGCCTGGGGCTGG - Intronic
1035730942 8:1853241-1853263 AGGGAAGGGCGGCCTGGGCAGGG - Intronic
1038052555 8:23827438-23827460 GAGGAGGGGTGGCCTGGCCCAGG + Intergenic
1038411070 8:27360405-27360427 GAGGAGGCCTGGCCTGGGCAGGG + Intronic
1038429797 8:27491084-27491106 GAGGAGGCGGGGCCAGGGCAGGG + Exonic
1039153065 8:34528554-34528576 CAGGAGGGGCGGCCTGGCAGAGG + Intergenic
1039413581 8:37375457-37375479 GAGGAGAGGGGGCCTGGGGGTGG - Intergenic
1039473662 8:37828306-37828328 GAGGTGGGGCAGGGTGGGAAAGG + Intronic
1039961413 8:42250643-42250665 GAGGAGGTGGGGGCAGGGAACGG + Intergenic
1040003670 8:42600161-42600183 GAGGAGGGGTGGCTTGGGCATGG + Intergenic
1040038200 8:42891667-42891689 GAGGACAGGCCACCTGGGAAAGG - Intronic
1040681911 8:49820754-49820776 GAGGAGGGGAGGGAAGGGAAGGG + Intergenic
1040916861 8:52573160-52573182 GATGAAGGGCGGCCTGGCAGAGG + Intergenic
1043107713 8:76135943-76135965 GAGGATGAGGGGCCTGTGAAGGG - Intergenic
1043395493 8:79831826-79831848 GACGAGGGGCGTGCTGGAAATGG + Intergenic
1043845388 8:85157262-85157284 GGGGAGTGGGGGCCTGGGAGAGG + Intergenic
1045067995 8:98469257-98469279 GCGGGGGGGCGGTCTGAGAATGG + Intronic
1045547342 8:103140698-103140720 GAGGAGGGACGGGCTGGGAGAGG + Exonic
1046625239 8:116569564-116569586 GAGGAGGGGAGGGGAGGGAAGGG + Intergenic
1047097472 8:121640219-121640241 AAGGAGGGGAGGCCCGGGAAAGG + Intronic
1047208166 8:122819942-122819964 TGGGAGGGGAGGCCTGGGGAGGG - Intronic
1047409815 8:124615199-124615221 GAGGAGGCCAGGCCTGGAAATGG + Intronic
1048325249 8:133434195-133434217 CAGGAGGGGCTGCCTGGCAGAGG + Intergenic
1049238081 8:141522724-141522746 GAGGAGGGGTGGCCAGACAAGGG - Intergenic
1049318405 8:141981971-141981993 GAGGAGGGGAGGGAGGGGAAGGG + Intergenic
1049463025 8:142738898-142738920 GGGGAGCGGCGGCCTGGGCCTGG - Intergenic
1049583547 8:143423102-143423124 GAGGAGGCAGGGCCTGGGAGAGG - Intronic
1049684028 8:143932110-143932132 GAGGTGGGGCTCCCTGGGTAGGG - Exonic
1049732480 8:144185711-144185733 GGGGAGGGGCGGCGGGGGGACGG + Intronic
1049755294 8:144308821-144308843 CAGAAGGGGCGGCCTGGGGAAGG + Intronic
1049789409 8:144465994-144466016 GAGGAGGGGGGGTCTGGGCGGGG + Intergenic
1049794219 8:144489216-144489238 GAGGGGGGTTGGCCTGGGAGGGG + Intronic
1049794228 8:144489233-144489255 GAGGGGGGTTGGCCTGGGAGGGG + Intronic
1049794258 8:144489299-144489321 GAGGGGGGTTGGACTGGGAAGGG + Intronic
1049812744 8:144582771-144582793 GAGAAGGGGCACCCTGGGGATGG + Intronic
1050209572 9:3238381-3238403 GAGAAGGGCTGGCCTGAGAAGGG + Intronic
1051287698 9:15513178-15513200 GGGGAGGGGAGGGCAGGGAACGG + Intergenic
1051996899 9:23228156-23228178 GAGGAGGGGTGGCTAGGCAAGGG + Intergenic
1052236216 9:26215178-26215200 CAGAAGGGGCGGCCGGGCAAAGG + Intergenic
1052360490 9:27551399-27551421 AGGGAGGTGGGGCCTGGGAAGGG - Intronic
1052706140 9:31995827-31995849 GGGGAGTGGGGGCCTGGGACAGG + Intergenic
1052852795 9:33387970-33387992 GAGGAGGGGGTGCGAGGGAAGGG - Intronic
1053069260 9:35091521-35091543 GAAGTGGGGGGGCCTGAGAAGGG + Exonic
1053129246 9:35605716-35605738 GAGGAGGGGCGGCCCCGGCCCGG - Exonic
1053214325 9:36258226-36258248 GGGGAGGGGAGGCCTGGGGCAGG + Intronic
1053680896 9:40484511-40484533 GAGGAGGGGGTGCGAGGGAAGGG - Intergenic
1053930884 9:43112825-43112847 GAGGAGGGGGTGCGAGGGAAGGG - Intergenic
1054282817 9:63140424-63140446 GAGGAGGGGGTGCGAGGGAAGGG + Intergenic
1054293978 9:63320026-63320048 GAGGAGGGGGTGCGAGGGAAGGG - Intergenic
1054392003 9:64624515-64624537 GAGGAGGGGGTGCGAGGGAAGGG - Intergenic
1054452938 9:65413043-65413065 GGGGAGGAGCAGCCTGGGATGGG - Intergenic
1054453008 9:65413301-65413323 GGGGAGGGGCAGCCTGGGAGCGG - Intergenic
1054503726 9:65891813-65891835 GAGGAGGGGGTGCGAGGGAAGGG + Intronic
1055586469 9:77762000-77762022 CAGGAGGGGCGGCCGGGCAGAGG - Intronic
1056461664 9:86814818-86814840 GAAGGGGGGCGGGCTGGGAGGGG + Intergenic
1056805002 9:89721642-89721664 GAGGTGGGGTGGGCTGGGGAAGG + Intergenic
1057313488 9:93955359-93955381 GAGGCGCGGCGGCGTGGGGAGGG - Exonic
1057439813 9:95074802-95074824 GAGCAGGTGCGGCCTGGGCCTGG - Intronic
1057633036 9:96736285-96736307 GAGGAGGGGAGGGGAGGGAAGGG - Intergenic
1057674838 9:97130534-97130556 CAGGAGGGGCGGCCGGGCAGAGG + Intergenic
1057695274 9:97318590-97318612 CAGGAGGGGCGGCCCAGGAGGGG + Intronic
1057695519 9:97320363-97320385 GAGGAGGGGAGGCCTTAGAAGGG - Intronic
1059527537 9:115006449-115006471 AAGGTGGGAGGGCCTGGGAAAGG - Intergenic
1059700659 9:116772689-116772711 GAGGAGGGAAGTCCTGGGAATGG - Intronic
1059880446 9:118683363-118683385 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1060026005 9:120172097-120172119 GTGGAGGGGGAGCTTGGGAAAGG - Intergenic
1060269120 9:122128608-122128630 GAAGGGAGGCGGCCCGGGAAGGG + Intergenic
1060875730 9:127082284-127082306 GAGGAGCTGCAGCCTGGCAAAGG + Intronic
1061301821 9:129709880-129709902 GTGAAGGGGAGGCATGGGAAGGG - Intronic
1061306643 9:129736370-129736392 GGGGAGCGGCTGCCTGGGGAGGG - Intergenic
1061360437 9:130138492-130138514 GAGGAGGAGCGGAAGGGGAAGGG - Exonic
1061416622 9:130450704-130450726 GAGGACGGGAGGCCTGGGAAAGG + Intronic
1061503863 9:131019757-131019779 GAGAAGGGGCTGCCTAGGAAGGG + Intronic
1061572623 9:131487157-131487179 GGGCAGCGGCGGCCTGTGAACGG - Exonic
1061588557 9:131583817-131583839 GAGGAGGAGTTTCCTGGGAAGGG - Intronic
1061845774 9:133387245-133387267 GTGGAGGTGGAGCCTGGGAATGG + Intronic
1062161462 9:135082649-135082671 GAGGCTGAGTGGCCTGGGAACGG - Intronic
1062206145 9:135338503-135338525 GAGAAGGGGAGGCCTGAGAGGGG + Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062316603 9:135970444-135970466 GAGGAGGGACGGCATGAGGAGGG - Intergenic
1062346856 9:136118968-136118990 GCGGAGGCGCGGCCCAGGAACGG - Intergenic
1062358343 9:136175693-136175715 AAGGAGGACCAGCCTGGGAACGG - Intergenic
1062436237 9:136547728-136547750 GCGGAGGGGCGGCCTGGGAGGGG + Intergenic
1062588685 9:137263377-137263399 GAGGAGGGAGGGCCGGGGAGCGG - Intronic
1062683420 9:137797348-137797370 GAGGAGGGCAGGGCTGGGAGCGG - Intronic
1062690157 9:137837512-137837534 GGGGAGTGCAGGCCTGGGAAGGG + Intronic
1062707692 9:137954343-137954365 GAGGATGGGAGCTCTGGGAATGG - Intronic
1062712362 9:137983441-137983463 GAGGAGGGCCGTCCTGGTCAGGG - Intronic
1203470547 Un_GL000220v1:113899-113921 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
1203478368 Un_GL000220v1:157871-157893 GAGGAGGGGCGGCGGGGGAAGGG - Intergenic
1185432136 X:17528-17550 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185432218 X:17720-17742 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185432300 X:17912-17934 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185432394 X:18136-18158 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185432476 X:18328-18350 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185432601 X:18615-18637 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185441603 X:230598-230620 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185441669 X:230759-230781 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185441764 X:230986-231008 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185441873 X:231244-231266 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1185441955 X:231436-231458 TAGGAGGGGGGGTCTGGGGATGG - Intergenic
1186464438 X:9774111-9774133 GAGGATGGGAGGTGTGGGAAGGG - Intronic
1187522076 X:20022545-20022567 GAGGAGGGACGGGAAGGGAAGGG + Intronic
1189308028 X:40001997-40002019 GATGACTGGCGGCCTGAGAATGG - Intergenic
1189893702 X:45632251-45632273 CAGGAGGGGCAGGCTGGGAGGGG + Intergenic
1190070542 X:47275812-47275834 GAGGCGGGGCGGCTTGGGGTGGG - Intergenic
1190370864 X:49739498-49739520 GAGGAAGGCTGGCCTTGGAATGG + Intergenic
1190834387 X:54087018-54087040 GATGAGGGGAGGCAAGGGAAAGG - Intronic
1191220838 X:57986147-57986169 CAGGAGGGGCAGGCTGGGAGGGG - Intergenic
1192013683 X:67303677-67303699 GGGGATGGGGGGCCAGGGAAGGG + Intergenic
1192225883 X:69227582-69227604 GAGGTGGGGCAGCCTGGGGGAGG - Intergenic
1192318082 X:70067270-70067292 AAGGAGGTGCTGGCTGGGAAAGG + Intergenic
1193782778 X:85723802-85723824 CAGTAGGGGCGGCCTGGCAGAGG + Intergenic
1195508820 X:105690068-105690090 GAGGATGGGGGGCTTGGGGAGGG + Intronic
1196184516 X:112731603-112731625 GAGGTGGGGTGGCCAGGCAATGG - Intergenic
1196246706 X:113408505-113408527 GAGGAGGGGAGGGGAGGGAAGGG - Intergenic
1197151456 X:123224400-123224422 GAGAAGGAGCAGACTGGGAATGG - Intronic
1197709090 X:129653601-129653623 GAGGACAGGCAGCCTGGGATGGG + Intronic
1197749912 X:129957279-129957301 GAGGAGCCGGGGCCTGGGCAGGG - Intergenic
1198141204 X:133805387-133805409 GAGCAGGGGCAGCCTAGGACTGG + Intronic
1198533797 X:137567827-137567849 GAGAGGTGGCGGCCAGGGAAAGG + Intronic
1199072158 X:143489746-143489768 GAGGAGGTGTGACCTTGGAAAGG - Intergenic
1199737027 X:150694008-150694030 GAGGATTGGTGGCCTGGGCAGGG - Intronic
1200091424 X:153637864-153637886 GCGGAGGGGCGCCCTGGCCATGG + Intergenic
1200111077 X:153741150-153741172 GGGCAGGGGCAGCCTGGGAGGGG + Intronic
1200247199 X:154532518-154532540 GAGGGTGGGCGGCCTGGGCCCGG - Intronic
1200835295 Y:7726327-7726349 GAGGAGGTGCAGCATAGGAAGGG + Intergenic
1201335841 Y:12878982-12879004 CAGGAGGGGCGGCCGGGCAGAGG - Intergenic