ID: 946623949

View in Genome Browser
Species Human (GRCh38)
Location 2:221591148-221591170
Sequence ATTAGCATGGGGAGGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946623949_946623956 29 Left 946623949 2:221591148-221591170 CCAGACTCCCTCCCCATGCTAAT No data
Right 946623956 2:221591200-221591222 ATGAATTAAGCAGTAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946623949 Original CRISPR ATTAGCATGGGGAGGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr