ID: 946623956

View in Genome Browser
Species Human (GRCh38)
Location 2:221591200-221591222
Sequence ATGAATTAAGCAGTAATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946623953_946623956 17 Left 946623953 2:221591160-221591182 CCCATGCTAATGACATTATAATG No data
Right 946623956 2:221591200-221591222 ATGAATTAAGCAGTAATTACAGG No data
946623949_946623956 29 Left 946623949 2:221591148-221591170 CCAGACTCCCTCCCCATGCTAAT No data
Right 946623956 2:221591200-221591222 ATGAATTAAGCAGTAATTACAGG No data
946623950_946623956 22 Left 946623950 2:221591155-221591177 CCCTCCCCATGCTAATGACATTA No data
Right 946623956 2:221591200-221591222 ATGAATTAAGCAGTAATTACAGG No data
946623951_946623956 21 Left 946623951 2:221591156-221591178 CCTCCCCATGCTAATGACATTAT No data
Right 946623956 2:221591200-221591222 ATGAATTAAGCAGTAATTACAGG No data
946623954_946623956 16 Left 946623954 2:221591161-221591183 CCATGCTAATGACATTATAATGA No data
Right 946623956 2:221591200-221591222 ATGAATTAAGCAGTAATTACAGG No data
946623952_946623956 18 Left 946623952 2:221591159-221591181 CCCCATGCTAATGACATTATAAT No data
Right 946623956 2:221591200-221591222 ATGAATTAAGCAGTAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946623956 Original CRISPR ATGAATTAAGCAGTAATTAC AGG Intergenic
No off target data available for this crispr