ID: 946627706

View in Genome Browser
Species Human (GRCh38)
Location 2:221632175-221632197
Sequence ATAGACTTGTCGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946627703_946627706 16 Left 946627703 2:221632136-221632158 CCAGACAAGAAATTTATTATTTT No data
Right 946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG No data
946627702_946627706 26 Left 946627702 2:221632126-221632148 CCTTACTTAGCCAGACAAGAAAT No data
Right 946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG No data
946627701_946627706 27 Left 946627701 2:221632125-221632147 CCCTTACTTAGCCAGACAAGAAA No data
Right 946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946627706 Original CRISPR ATAGACTTGTCGGCCAGGTG CGG Intergenic
No off target data available for this crispr