ID: 946629562

View in Genome Browser
Species Human (GRCh38)
Location 2:221652262-221652284
Sequence GATGCAGTCAAGAGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629562_946629567 11 Left 946629562 2:221652262-221652284 CCAGAAACACTCTTGACTGCATC No data
Right 946629567 2:221652296-221652318 GGGAACTCTTGATAGGTCTTTGG No data
946629562_946629564 -10 Left 946629562 2:221652262-221652284 CCAGAAACACTCTTGACTGCATC No data
Right 946629564 2:221652275-221652297 TGACTGCATCAGGAATTGAGTGG No data
946629562_946629565 -9 Left 946629562 2:221652262-221652284 CCAGAAACACTCTTGACTGCATC No data
Right 946629565 2:221652276-221652298 GACTGCATCAGGAATTGAGTGGG No data
946629562_946629566 4 Left 946629562 2:221652262-221652284 CCAGAAACACTCTTGACTGCATC No data
Right 946629566 2:221652289-221652311 ATTGAGTGGGAACTCTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629562 Original CRISPR GATGCAGTCAAGAGTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr