ID: 946629565

View in Genome Browser
Species Human (GRCh38)
Location 2:221652276-221652298
Sequence GACTGCATCAGGAATTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629561_946629565 1 Left 946629561 2:221652252-221652274 CCATAATTGACCAGAAACACTCT No data
Right 946629565 2:221652276-221652298 GACTGCATCAGGAATTGAGTGGG No data
946629562_946629565 -9 Left 946629562 2:221652262-221652284 CCAGAAACACTCTTGACTGCATC No data
Right 946629565 2:221652276-221652298 GACTGCATCAGGAATTGAGTGGG No data
946629560_946629565 10 Left 946629560 2:221652243-221652265 CCTTGAGGGCCATAATTGACCAG No data
Right 946629565 2:221652276-221652298 GACTGCATCAGGAATTGAGTGGG No data
946629559_946629565 20 Left 946629559 2:221652233-221652255 CCTCTTAATTCCTTGAGGGCCAT No data
Right 946629565 2:221652276-221652298 GACTGCATCAGGAATTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629565 Original CRISPR GACTGCATCAGGAATTGAGT GGG Intergenic
No off target data available for this crispr