ID: 946629567

View in Genome Browser
Species Human (GRCh38)
Location 2:221652296-221652318
Sequence GGGAACTCTTGATAGGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629561_946629567 21 Left 946629561 2:221652252-221652274 CCATAATTGACCAGAAACACTCT No data
Right 946629567 2:221652296-221652318 GGGAACTCTTGATAGGTCTTTGG No data
946629560_946629567 30 Left 946629560 2:221652243-221652265 CCTTGAGGGCCATAATTGACCAG No data
Right 946629567 2:221652296-221652318 GGGAACTCTTGATAGGTCTTTGG No data
946629562_946629567 11 Left 946629562 2:221652262-221652284 CCAGAAACACTCTTGACTGCATC No data
Right 946629567 2:221652296-221652318 GGGAACTCTTGATAGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629567 Original CRISPR GGGAACTCTTGATAGGTCTT TGG Intergenic
No off target data available for this crispr