ID: 946629896

View in Genome Browser
Species Human (GRCh38)
Location 2:221655781-221655803
Sequence ATTTGGATGAGCCATGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629896_946629902 17 Left 946629896 2:221655781-221655803 CCACCACCATGGCTCATCCAAAT No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data
946629896_946629903 18 Left 946629896 2:221655781-221655803 CCACCACCATGGCTCATCCAAAT No data
Right 946629903 2:221655822-221655844 CGCTATGATACCACGTGGTTGGG No data
946629896_946629901 13 Left 946629896 2:221655781-221655803 CCACCACCATGGCTCATCCAAAT No data
Right 946629901 2:221655817-221655839 AGATTCGCTATGATACCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629896 Original CRISPR ATTTGGATGAGCCATGGTGG TGG (reversed) Intergenic