ID: 946629896 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:221655781-221655803 |
| Sequence | ATTTGGATGAGCCATGGTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946629896_946629902 | 17 | Left | 946629896 | 2:221655781-221655803 | CCACCACCATGGCTCATCCAAAT | No data | ||
| Right | 946629902 | 2:221655821-221655843 | TCGCTATGATACCACGTGGTTGG | No data | ||||
| 946629896_946629903 | 18 | Left | 946629896 | 2:221655781-221655803 | CCACCACCATGGCTCATCCAAAT | No data | ||
| Right | 946629903 | 2:221655822-221655844 | CGCTATGATACCACGTGGTTGGG | No data | ||||
| 946629896_946629901 | 13 | Left | 946629896 | 2:221655781-221655803 | CCACCACCATGGCTCATCCAAAT | No data | ||
| Right | 946629901 | 2:221655817-221655839 | AGATTCGCTATGATACCACGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946629896 | Original CRISPR | ATTTGGATGAGCCATGGTGG TGG (reversed) | Intergenic | ||