ID: 946629897

View in Genome Browser
Species Human (GRCh38)
Location 2:221655784-221655806
Sequence AGCATTTGGATGAGCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629897_946629906 30 Left 946629897 2:221655784-221655806 CCACCATGGCTCATCCAAATGCT No data
Right 946629906 2:221655837-221655859 TGGTTGGGTCCATGCAGATTGGG No data
946629897_946629905 29 Left 946629897 2:221655784-221655806 CCACCATGGCTCATCCAAATGCT No data
Right 946629905 2:221655836-221655858 GTGGTTGGGTCCATGCAGATTGG No data
946629897_946629901 10 Left 946629897 2:221655784-221655806 CCACCATGGCTCATCCAAATGCT No data
Right 946629901 2:221655817-221655839 AGATTCGCTATGATACCACGTGG No data
946629897_946629903 15 Left 946629897 2:221655784-221655806 CCACCATGGCTCATCCAAATGCT No data
Right 946629903 2:221655822-221655844 CGCTATGATACCACGTGGTTGGG No data
946629897_946629902 14 Left 946629897 2:221655784-221655806 CCACCATGGCTCATCCAAATGCT No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629897 Original CRISPR AGCATTTGGATGAGCCATGG TGG (reversed) Intergenic