ID: 946629898

View in Genome Browser
Species Human (GRCh38)
Location 2:221655787-221655809
Sequence TGGAGCATTTGGATGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629898_946629905 26 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629905 2:221655836-221655858 GTGGTTGGGTCCATGCAGATTGG No data
946629898_946629907 28 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629907 2:221655838-221655860 GGTTGGGTCCATGCAGATTGGGG No data
946629898_946629903 12 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629903 2:221655822-221655844 CGCTATGATACCACGTGGTTGGG No data
946629898_946629901 7 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629901 2:221655817-221655839 AGATTCGCTATGATACCACGTGG No data
946629898_946629906 27 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629906 2:221655837-221655859 TGGTTGGGTCCATGCAGATTGGG No data
946629898_946629902 11 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629898 Original CRISPR TGGAGCATTTGGATGAGCCA TGG (reversed) Intergenic