ID: 946629899

View in Genome Browser
Species Human (GRCh38)
Location 2:221655798-221655820
Sequence ATCTAAATTACTGGAGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629899_946629902 0 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data
946629899_946629906 16 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629906 2:221655837-221655859 TGGTTGGGTCCATGCAGATTGGG No data
946629899_946629901 -4 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629901 2:221655817-221655839 AGATTCGCTATGATACCACGTGG No data
946629899_946629908 20 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629908 2:221655841-221655863 TGGGTCCATGCAGATTGGGGTGG No data
946629899_946629903 1 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629903 2:221655822-221655844 CGCTATGATACCACGTGGTTGGG No data
946629899_946629907 17 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629907 2:221655838-221655860 GGTTGGGTCCATGCAGATTGGGG No data
946629899_946629905 15 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629905 2:221655836-221655858 GTGGTTGGGTCCATGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629899 Original CRISPR ATCTAAATTACTGGAGCATT TGG (reversed) Intergenic