ID: 946629902

View in Genome Browser
Species Human (GRCh38)
Location 2:221655821-221655843
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629897_946629902 14 Left 946629897 2:221655784-221655806 CCACCATGGCTCATCCAAATGCT No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data
946629898_946629902 11 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data
946629899_946629902 0 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data
946629896_946629902 17 Left 946629896 2:221655781-221655803 CCACCACCATGGCTCATCCAAAT No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data
946629900_946629902 -9 Left 946629900 2:221655807-221655829 CCAGTAATTTAGATTCGCTATGA No data
Right 946629902 2:221655821-221655843 TCGCTATGATACCACGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type