ID: 946629902 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:221655821-221655843 |
Sequence | TCGCTATGATACCACGTGGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946629897_946629902 | 14 | Left | 946629897 | 2:221655784-221655806 | CCACCATGGCTCATCCAAATGCT | No data | ||
Right | 946629902 | 2:221655821-221655843 | TCGCTATGATACCACGTGGTTGG | No data | ||||
946629899_946629902 | 0 | Left | 946629899 | 2:221655798-221655820 | CCAAATGCTCCAGTAATTTAGAT | No data | ||
Right | 946629902 | 2:221655821-221655843 | TCGCTATGATACCACGTGGTTGG | No data | ||||
946629900_946629902 | -9 | Left | 946629900 | 2:221655807-221655829 | CCAGTAATTTAGATTCGCTATGA | No data | ||
Right | 946629902 | 2:221655821-221655843 | TCGCTATGATACCACGTGGTTGG | No data | ||||
946629896_946629902 | 17 | Left | 946629896 | 2:221655781-221655803 | CCACCACCATGGCTCATCCAAAT | No data | ||
Right | 946629902 | 2:221655821-221655843 | TCGCTATGATACCACGTGGTTGG | No data | ||||
946629898_946629902 | 11 | Left | 946629898 | 2:221655787-221655809 | CCATGGCTCATCCAAATGCTCCA | No data | ||
Right | 946629902 | 2:221655821-221655843 | TCGCTATGATACCACGTGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946629902 | Original CRISPR | TCGCTATGATACCACGTGGT TGG | Intergenic | ||