ID: 946629906

View in Genome Browser
Species Human (GRCh38)
Location 2:221655837-221655859
Sequence TGGTTGGGTCCATGCAGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629897_946629906 30 Left 946629897 2:221655784-221655806 CCACCATGGCTCATCCAAATGCT No data
Right 946629906 2:221655837-221655859 TGGTTGGGTCCATGCAGATTGGG No data
946629898_946629906 27 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629906 2:221655837-221655859 TGGTTGGGTCCATGCAGATTGGG No data
946629899_946629906 16 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629906 2:221655837-221655859 TGGTTGGGTCCATGCAGATTGGG No data
946629900_946629906 7 Left 946629900 2:221655807-221655829 CCAGTAATTTAGATTCGCTATGA No data
Right 946629906 2:221655837-221655859 TGGTTGGGTCCATGCAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629906 Original CRISPR TGGTTGGGTCCATGCAGATT GGG Intergenic
No off target data available for this crispr