ID: 946629907

View in Genome Browser
Species Human (GRCh38)
Location 2:221655838-221655860
Sequence GGTTGGGTCCATGCAGATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629900_946629907 8 Left 946629900 2:221655807-221655829 CCAGTAATTTAGATTCGCTATGA No data
Right 946629907 2:221655838-221655860 GGTTGGGTCCATGCAGATTGGGG No data
946629899_946629907 17 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629907 2:221655838-221655860 GGTTGGGTCCATGCAGATTGGGG No data
946629898_946629907 28 Left 946629898 2:221655787-221655809 CCATGGCTCATCCAAATGCTCCA No data
Right 946629907 2:221655838-221655860 GGTTGGGTCCATGCAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629907 Original CRISPR GGTTGGGTCCATGCAGATTG GGG Intergenic
No off target data available for this crispr