ID: 946629907 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:221655838-221655860 |
| Sequence | GGTTGGGTCCATGCAGATTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946629899_946629907 | 17 | Left | 946629899 | 2:221655798-221655820 | CCAAATGCTCCAGTAATTTAGAT | No data | ||
| Right | 946629907 | 2:221655838-221655860 | GGTTGGGTCCATGCAGATTGGGG | No data | ||||
| 946629898_946629907 | 28 | Left | 946629898 | 2:221655787-221655809 | CCATGGCTCATCCAAATGCTCCA | No data | ||
| Right | 946629907 | 2:221655838-221655860 | GGTTGGGTCCATGCAGATTGGGG | No data | ||||
| 946629900_946629907 | 8 | Left | 946629900 | 2:221655807-221655829 | CCAGTAATTTAGATTCGCTATGA | No data | ||
| Right | 946629907 | 2:221655838-221655860 | GGTTGGGTCCATGCAGATTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946629907 | Original CRISPR | GGTTGGGTCCATGCAGATTG GGG | Intergenic | ||