ID: 946629908

View in Genome Browser
Species Human (GRCh38)
Location 2:221655841-221655863
Sequence TGGGTCCATGCAGATTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946629900_946629908 11 Left 946629900 2:221655807-221655829 CCAGTAATTTAGATTCGCTATGA No data
Right 946629908 2:221655841-221655863 TGGGTCCATGCAGATTGGGGTGG No data
946629899_946629908 20 Left 946629899 2:221655798-221655820 CCAAATGCTCCAGTAATTTAGAT No data
Right 946629908 2:221655841-221655863 TGGGTCCATGCAGATTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946629908 Original CRISPR TGGGTCCATGCAGATTGGGG TGG Intergenic
No off target data available for this crispr