ID: 946632931

View in Genome Browser
Species Human (GRCh38)
Location 2:221690853-221690875
Sequence TGGCAGAGCCAAAGTAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946632927_946632931 -4 Left 946632927 2:221690834-221690856 CCAGATGGCTGCCGCAAGATGGC No data
Right 946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG No data
946632922_946632931 28 Left 946632922 2:221690802-221690824 CCTCCCTTGTTGTATCAGAAAGA No data
Right 946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG No data
946632923_946632931 25 Left 946632923 2:221690805-221690827 CCCTTGTTGTATCAGAAAGATCA No data
Right 946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG No data
946632924_946632931 24 Left 946632924 2:221690806-221690828 CCTTGTTGTATCAGAAAGATCAC No data
Right 946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946632931 Original CRISPR TGGCAGAGCCAAAGTAGGCA GGG Intergenic
No off target data available for this crispr