ID: 946634243

View in Genome Browser
Species Human (GRCh38)
Location 2:221707022-221707044
Sequence AAATTGGTAGGGAGATTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946634243_946634251 0 Left 946634243 2:221707022-221707044 CCCCCTAATCTCCCTACCAATTT No data
Right 946634251 2:221707045-221707067 CCTCCCCACCCAGCCCTTCCAGG No data
946634243_946634257 11 Left 946634243 2:221707022-221707044 CCCCCTAATCTCCCTACCAATTT No data
Right 946634257 2:221707056-221707078 AGCCCTTCCAGGAGCTGATATGG No data
946634243_946634258 12 Left 946634243 2:221707022-221707044 CCCCCTAATCTCCCTACCAATTT No data
Right 946634258 2:221707057-221707079 GCCCTTCCAGGAGCTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946634243 Original CRISPR AAATTGGTAGGGAGATTAGG GGG (reversed) Intergenic
No off target data available for this crispr