ID: 946634387

View in Genome Browser
Species Human (GRCh38)
Location 2:221708110-221708132
Sequence ACTGGGAATAGGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946634387_946634394 15 Left 946634387 2:221708110-221708132 CCCTCCACTTTCCTATTCCCAGT No data
Right 946634394 2:221708148-221708170 TCATACCTTACTTCAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946634387 Original CRISPR ACTGGGAATAGGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr