ID: 946634640 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:221711228-221711250 |
| Sequence | AAGTGAATAAGGATCTAACA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946634640_946634644 | 27 | Left | 946634640 | 2:221711228-221711250 | CCCTGTTAGATCCTTATTCACTT | No data | ||
| Right | 946634644 | 2:221711278-221711300 | CTAGACCATGAGCTCCTTGAAGG | 0: 3 1: 18 2: 117 3: 475 4: 1528 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946634640 | Original CRISPR | AAGTGAATAAGGATCTAACA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||