ID: 946634640

View in Genome Browser
Species Human (GRCh38)
Location 2:221711228-221711250
Sequence AAGTGAATAAGGATCTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946634640_946634644 27 Left 946634640 2:221711228-221711250 CCCTGTTAGATCCTTATTCACTT No data
Right 946634644 2:221711278-221711300 CTAGACCATGAGCTCCTTGAAGG 0: 3
1: 18
2: 117
3: 475
4: 1528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946634640 Original CRISPR AAGTGAATAAGGATCTAACA GGG (reversed) Intergenic
No off target data available for this crispr