ID: 946638678

View in Genome Browser
Species Human (GRCh38)
Location 2:221758969-221758991
Sequence ATGGCTAAGTGCCATTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946638672_946638678 20 Left 946638672 2:221758926-221758948 CCTGGTAGCAGGTGTTTGGATCA No data
Right 946638678 2:221758969-221758991 ATGGCTAAGTGCCATTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946638678 Original CRISPR ATGGCTAAGTGCCATTTCCT TGG Intergenic
No off target data available for this crispr