ID: 946650443

View in Genome Browser
Species Human (GRCh38)
Location 2:221887483-221887505
Sequence AGGGAGAAGAAGAATGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946650436_946650443 20 Left 946650436 2:221887440-221887462 CCTAACTTCAAGGTCAGCTGGGA No data
Right 946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946650443 Original CRISPR AGGGAGAAGAAGAATGGGTA GGG Intergenic
No off target data available for this crispr