ID: 946650964

View in Genome Browser
Species Human (GRCh38)
Location 2:221892268-221892290
Sequence GGGGTTCTCACTTAGACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946650964_946650979 27 Left 946650964 2:221892268-221892290 CCTGACGTCTAAGTGAGAACCCC No data
Right 946650979 2:221892318-221892340 AAGTGAGGAGCATCTCCGCCCGG 0: 150
1: 1762
2: 5207
3: 7889
4: 6345
946650964_946650971 4 Left 946650964 2:221892268-221892290 CCTGACGTCTAAGTGAGAACCCC No data
Right 946650971 2:221892295-221892317 GCCCAGCAGCCACCCCGTCTGGG 0: 100
1: 817
2: 3223
3: 3663
4: 3458
946650964_946650974 12 Left 946650964 2:221892268-221892290 CCTGACGTCTAAGTGAGAACCCC No data
Right 946650974 2:221892303-221892325 GCCACCCCGTCTGGGAAGTGAGG 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
946650964_946650970 3 Left 946650964 2:221892268-221892290 CCTGACGTCTAAGTGAGAACCCC No data
Right 946650970 2:221892294-221892316 CGCCCAGCAGCCACCCCGTCTGG 0: 158
1: 1010
2: 1497
3: 2418
4: 2973

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946650964 Original CRISPR GGGGTTCTCACTTAGACGTC AGG (reversed) Intergenic
No off target data available for this crispr