ID: 946652550

View in Genome Browser
Species Human (GRCh38)
Location 2:221909175-221909197
Sequence CTTGTGATCAGAAGTGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946652548_946652550 23 Left 946652548 2:221909129-221909151 CCAGGACTAGGAGCTGGAGCATG No data
Right 946652550 2:221909175-221909197 CTTGTGATCAGAAGTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946652550 Original CRISPR CTTGTGATCAGAAGTGTCTC AGG Intergenic
No off target data available for this crispr