ID: 946660857

View in Genome Browser
Species Human (GRCh38)
Location 2:221997922-221997944
Sequence GTGTGGGCTACAAGCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946660848_946660857 10 Left 946660848 2:221997889-221997911 CCATGAGGTGTGAGATGGAGCAG No data
Right 946660857 2:221997922-221997944 GTGTGGGCTACAAGCATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946660857 Original CRISPR GTGTGGGCTACAAGCATGGA TGG Intergenic
No off target data available for this crispr