ID: 946661622

View in Genome Browser
Species Human (GRCh38)
Location 2:222007150-222007172
Sequence TCCCCCACACAGACCAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946661622_946661625 10 Left 946661622 2:222007150-222007172 CCAACCTTGGTCTGTGTGGGGGA No data
Right 946661625 2:222007183-222007205 CTCAGGACCCTGCTGAGCCAAGG No data
946661622_946661624 -7 Left 946661622 2:222007150-222007172 CCAACCTTGGTCTGTGTGGGGGA No data
Right 946661624 2:222007166-222007188 TGGGGGAAAAAGACTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946661622 Original CRISPR TCCCCCACACAGACCAAGGT TGG (reversed) Intergenic
No off target data available for this crispr