ID: 946663912

View in Genome Browser
Species Human (GRCh38)
Location 2:222029684-222029706
Sequence CAGTGTTCCTCAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946663908_946663912 21 Left 946663908 2:222029640-222029662 CCTTCAAAAAATAAAACATATGT No data
Right 946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946663912 Original CRISPR CAGTGTTCCTCAAGGGAAGA GGG Intergenic
No off target data available for this crispr