ID: 946668034

View in Genome Browser
Species Human (GRCh38)
Location 2:222071669-222071691
Sequence TTGTTCCCCTTTTATATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946668033_946668034 1 Left 946668033 2:222071645-222071667 CCTTTAAGTTAGGTACAAGTGTC No data
Right 946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG No data
946668032_946668034 9 Left 946668032 2:222071637-222071659 CCAACAATCCTTTAAGTTAGGTA No data
Right 946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG No data
946668029_946668034 13 Left 946668029 2:222071633-222071655 CCTCCCAACAATCCTTTAAGTTA No data
Right 946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG No data
946668031_946668034 10 Left 946668031 2:222071636-222071658 CCCAACAATCCTTTAAGTTAGGT No data
Right 946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946668034 Original CRISPR TTGTTCCCCTTTTATATTTA AGG Intergenic
No off target data available for this crispr