ID: 946668654

View in Genome Browser
Species Human (GRCh38)
Location 2:222078195-222078217
Sequence AAGCTGTAATTGTTGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946668651_946668654 17 Left 946668651 2:222078155-222078177 CCACTGAGTATTTCAATTATTTG No data
Right 946668654 2:222078195-222078217 AAGCTGTAATTGTTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946668654 Original CRISPR AAGCTGTAATTGTTGAGACA GGG Intergenic
No off target data available for this crispr