ID: 946672811

View in Genome Browser
Species Human (GRCh38)
Location 2:222124355-222124377
Sequence GCTTGCAGAAGGAGGACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946672811_946672817 29 Left 946672811 2:222124355-222124377 CCAAGTGTCCTCCTTCTGCAAGC No data
Right 946672817 2:222124407-222124429 ATCTATTATTTGTAAAGCTTTGG No data
946672811_946672818 30 Left 946672811 2:222124355-222124377 CCAAGTGTCCTCCTTCTGCAAGC No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946672811 Original CRISPR GCTTGCAGAAGGAGGACACT TGG (reversed) Intergenic