ID: 946672812

View in Genome Browser
Species Human (GRCh38)
Location 2:222124363-222124385
Sequence ATAATTAGGCTTGCAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946672812_946672818 22 Left 946672812 2:222124363-222124385 CCTCCTTCTGCAAGCCTAATTAT No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data
946672812_946672817 21 Left 946672812 2:222124363-222124385 CCTCCTTCTGCAAGCCTAATTAT No data
Right 946672817 2:222124407-222124429 ATCTATTATTTGTAAAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946672812 Original CRISPR ATAATTAGGCTTGCAGAAGG AGG (reversed) Intergenic