ID: 946672813

View in Genome Browser
Species Human (GRCh38)
Location 2:222124366-222124388
Sequence AAAATAATTAGGCTTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946672813_946672818 19 Left 946672813 2:222124366-222124388 CCTTCTGCAAGCCTAATTATTTT No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data
946672813_946672817 18 Left 946672813 2:222124366-222124388 CCTTCTGCAAGCCTAATTATTTT No data
Right 946672817 2:222124407-222124429 ATCTATTATTTGTAAAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946672813 Original CRISPR AAAATAATTAGGCTTGCAGA AGG (reversed) Intergenic