ID: 946672814

View in Genome Browser
Species Human (GRCh38)
Location 2:222124377-222124399
Sequence GGATGTCTGTTAAAATAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946672814_946672819 20 Left 946672814 2:222124377-222124399 CCTAATTATTTTAACAGACATCC No data
Right 946672819 2:222124420-222124442 AAAGCTTTGGGCTATACCTGAGG No data
946672814_946672817 7 Left 946672814 2:222124377-222124399 CCTAATTATTTTAACAGACATCC No data
Right 946672817 2:222124407-222124429 ATCTATTATTTGTAAAGCTTTGG No data
946672814_946672818 8 Left 946672814 2:222124377-222124399 CCTAATTATTTTAACAGACATCC No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946672814 Original CRISPR GGATGTCTGTTAAAATAATT AGG (reversed) Intergenic