ID: 946672818

View in Genome Browser
Species Human (GRCh38)
Location 2:222124408-222124430
Sequence TCTATTATTTGTAAAGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946672811_946672818 30 Left 946672811 2:222124355-222124377 CCAAGTGTCCTCCTTCTGCAAGC No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data
946672813_946672818 19 Left 946672813 2:222124366-222124388 CCTTCTGCAAGCCTAATTATTTT No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data
946672814_946672818 8 Left 946672814 2:222124377-222124399 CCTAATTATTTTAACAGACATCC No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data
946672812_946672818 22 Left 946672812 2:222124363-222124385 CCTCCTTCTGCAAGCCTAATTAT No data
Right 946672818 2:222124408-222124430 TCTATTATTTGTAAAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946672818 Original CRISPR TCTATTATTTGTAAAGCTTT GGG Intergenic