ID: 946679850

View in Genome Browser
Species Human (GRCh38)
Location 2:222202091-222202113
Sequence GGGTCTGGAACCTACCACCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946679850_946679861 11 Left 946679850 2:222202091-222202113 CCGTGGTGGTAGGTTCCAGACCC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 946679861 2:222202125-222202147 GGAGAGCGCGTAATCAGTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 31
946679850_946679862 12 Left 946679850 2:222202091-222202113 CCGTGGTGGTAGGTTCCAGACCC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 946679862 2:222202126-222202148 GAGAGCGCGTAATCAGTCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
946679850_946679854 -10 Left 946679850 2:222202091-222202113 CCGTGGTGGTAGGTTCCAGACCC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 946679854 2:222202104-222202126 TTCCAGACCCCCGGTGAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 99
946679850_946679860 10 Left 946679850 2:222202091-222202113 CCGTGGTGGTAGGTTCCAGACCC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 946679860 2:222202124-222202146 GGGAGAGCGCGTAATCAGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 19
946679850_946679863 21 Left 946679850 2:222202091-222202113 CCGTGGTGGTAGGTTCCAGACCC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 946679863 2:222202135-222202157 TAATCAGTCTGGGGCTGATGAGG 0: 1
1: 0
2: 1
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946679850 Original CRISPR GGGTCTGGAACCTACCACCA CGG (reversed) Exonic
901155379 1:7133980-7134002 GGGTATGGATCCCACCACCCAGG + Intronic
901758751 1:11457140-11457162 TGGTTTGGAACCTAACACCCAGG - Intergenic
904598186 1:31659649-31659671 GGCTCTGGAACGTGCCACCTGGG - Intronic
905910440 1:41649741-41649763 GGGTCTGGAACTCATCCCCAGGG - Intronic
907507054 1:54926916-54926938 GGGTCTGGAACCCAACCCCTGGG - Intergenic
909161293 1:72153034-72153056 GGGTATGGATCCTATTACCAAGG - Intronic
910153374 1:84182801-84182823 GGTCCTGGAACCAACCCCCAGGG + Intronic
912183947 1:107251966-107251988 GGCTCTGGAACCAGCCTCCATGG + Intronic
912489345 1:110053224-110053246 GTTTCTGGAATATACCACCATGG + Intronic
915369180 1:155333670-155333692 GGATTTGGTACCTACCACAAAGG + Intergenic
918311224 1:183286906-183286928 GGGTCTAGAACCCATCCCCAGGG - Intronic
919937909 1:202266806-202266828 GGGTGTGGAACCTTCAGCCACGG - Intronic
921524459 1:216200497-216200519 GGGTCAGTAAACTACCACCAAGG + Intronic
922053828 1:222021336-222021358 GGTCCTGGAATCTACCACTACGG - Intergenic
1064406525 10:15069234-15069256 GGGGCAGGAATCTTCCACCAAGG - Intronic
1069995925 10:72342204-72342226 GGGCCTGGAGCCTCCCACCAGGG + Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1073610711 10:104939933-104939955 GGGTCTGGATCCAGACACCAAGG + Intronic
1077311494 11:1890836-1890858 GGGGCTAGAACCTGCCTCCAGGG + Exonic
1083004069 11:59324789-59324811 GGGTATGGATCCCATCACCAAGG + Intergenic
1084525455 11:69695001-69695023 GGGGCTGGAACCCGCCACCCCGG - Intergenic
1084669718 11:70597898-70597920 GGGTCTGGATCCTGCCACTCTGG - Intronic
1087002391 11:93434092-93434114 GGGTAGGGGACCAACCACCATGG + Intronic
1087338528 11:96873376-96873398 GAGTCTCAAACCTACGACCAAGG + Intergenic
1088738940 11:112751233-112751255 GGGTCAGGAGCCTAGCACAATGG - Intergenic
1089927273 11:122271538-122271560 GGGCCTGGCACATACCACCTGGG + Intergenic
1090946480 11:131433970-131433992 GGGCGGGGAACCTACCACCCCGG - Intronic
1094040557 12:26116876-26116898 GAGTCTGAAACCTCTCACCATGG + Intergenic
1095827860 12:46549157-46549179 GGGTAGGGAACCTACAACCTTGG - Intergenic
1104720748 12:131043860-131043882 GGGACTGAAACCCACCACCCTGG + Intronic
1106234249 13:27848340-27848362 AGTTCTAGAACATACCACCATGG + Intergenic
1113439077 13:110313872-110313894 GGGGCTGGAACCCAGCACCGAGG - Intronic
1113647525 13:112009597-112009619 CGCACTGGAACCTAACACCAGGG + Intergenic
1119164533 14:72481051-72481073 GGGTCTGAAACCGACCATCGAGG + Intronic
1121754374 14:96391283-96391305 GCGTCTGGAAACAACCCCCAAGG + Intergenic
1126371643 15:47953358-47953380 AGCTCTGGAACCTGCCACCTTGG + Intergenic
1127269905 15:57391030-57391052 GGGTCTGGAAGCTACAGCCTAGG - Intronic
1128127120 15:65201369-65201391 AGATCTGAATCCTACCACCATGG - Intronic
1128128439 15:65210063-65210085 GGCCCTGGAGCCTACCCCCAGGG - Intronic
1128954688 15:71927489-71927511 GGTTCTGGAACCAATCCCCATGG - Intronic
1131952429 15:97694970-97694992 GGGCCTCTAACCTTCCACCATGG - Intergenic
1133044631 16:3080889-3080911 GGGTCTGGTTCCTTCCACCTTGG - Intronic
1137734870 16:50716358-50716380 GGGTCTGGATCCTACGTCCTGGG + Intronic
1142551081 17:740103-740125 GTGTCTGGGACCTACCATCTAGG + Intronic
1145984086 17:29032655-29032677 GTGTTTGGAACAGACCACCAGGG - Intronic
1146279204 17:31534106-31534128 GGCTCTGGGACCTGCCACCAAGG - Exonic
1150410818 17:64939274-64939296 GGCTCTGGAACCAGCCAACATGG + Intergenic
1150892933 17:69175661-69175683 GGGAATGGAACCTGCCACTAAGG - Intronic
1152777676 17:82212904-82212926 GGGGCCGGAACCTAGCGCCAGGG - Intergenic
1152805203 17:82352410-82352432 TGGTCTGGATCCTACCTCCTAGG - Intergenic
1157283044 18:46358681-46358703 GGGTCTGGAACCTGTCAGTAAGG - Intronic
1158598452 18:58836941-58836963 GGTCCTGGAACCAACCCCCATGG - Intergenic
1160385786 18:78495418-78495440 GGTTCTGGAAACTTCTACCATGG - Intergenic
1161167997 19:2798781-2798803 GGGTCTGGAGCCCAGCTCCATGG - Intronic
1162417190 19:10544924-10544946 GGGTCTGTCAGCTGCCACCAGGG - Intronic
1164315100 19:24080451-24080473 GGGACTGAGACCTTCCACCACGG + Intronic
1166251336 19:41572998-41573020 GGGTCTGGATCCTCCTCCCAGGG - Intronic
1166896591 19:46026562-46026584 GGATATGCAACCCACCACCAAGG + Intergenic
1168100780 19:54139820-54139842 GGGGCTGGAATCTCCCACCTTGG - Intronic
926619041 2:15030498-15030520 GGGAATGGAGCCTACCATCAAGG - Intergenic
935950595 2:108325238-108325260 GGGCCTGGAACCTAGCATCTGGG - Intergenic
936543690 2:113372547-113372569 TGATCTGGAACCAACCACTATGG + Intergenic
939000587 2:136729466-136729488 GGGTGTGAAACCTAACATCATGG - Intergenic
942434332 2:175955277-175955299 GGTCTTGGAACCTGCCACCAGGG + Intronic
943897885 2:193390698-193390720 GGGTATGGATCCTGCCACCCAGG + Intergenic
944407821 2:199405391-199405413 GATTCTGGGATCTACCACCAGGG + Intronic
946172524 2:217904032-217904054 GGGTCTGTAAGCGAACACCAGGG + Intronic
946679850 2:222202091-222202113 GGGTCTGGAACCTACCACCACGG - Exonic
947808110 2:232982337-232982359 AGGGCTTGAACCTACCATCAAGG + Intronic
948655042 2:239471222-239471244 GGGGCTGAGACCTTCCACCACGG + Intergenic
1169351798 20:4873938-4873960 GGGTATGGAACCTTAAACCACGG + Exonic
1172516959 20:35541886-35541908 GGGTCTGGAAGCTACTGCCCCGG - Intergenic
1175783233 20:61696687-61696709 GGCTCTAGAACATACTACCAGGG + Intronic
1179459857 21:41526989-41527011 GGGACTGGAGCTTACCCCCAGGG + Intronic
1184313906 22:43667436-43667458 GGCCCTGGAACCTACCAGCCAGG - Intronic
951783938 3:26397230-26397252 GGCTCTTGAACCAACCCCCAAGG - Intergenic
952200950 3:31126766-31126788 GGATCTGGAATATACCACTATGG - Intergenic
953885346 3:46711879-46711901 GGGCCTGGAACATACCGCCCAGG - Intergenic
954636978 3:52076289-52076311 GGGTCAGGAACCCCCCACCCTGG + Intronic
957178557 3:76845950-76845972 GGGTCTGGAACCAACCACTGTGG + Intronic
957480337 3:80784565-80784587 TTTTCTGGAACCTACCAACAAGG + Intergenic
961345935 3:126263460-126263482 GGGTCTGGATCCTCACACCCTGG - Intergenic
963626626 3:147681378-147681400 GGGTTTGGCTCCTAACACCAAGG + Intergenic
972538922 4:40022120-40022142 TGGTCTGGAACTCACCACCTTGG + Intergenic
976787488 4:88838177-88838199 GGTCCTGAAACCTACCCCCAGGG + Intronic
978005328 4:103608465-103608487 GGGTCTGGATTCTATCACCCAGG - Intronic
984951481 4:185011011-185011033 GCGTCTGGAACCTGCGACCTGGG - Intergenic
986019857 5:3791036-3791058 GGTTCTGGAACTTACAACAAAGG + Intergenic
986209324 5:5655688-5655710 GGGTATGGATCCTATCACCCAGG - Intergenic
994954916 5:106515929-106515951 GGGTCTGGAACCAATCCCCCAGG + Intergenic
996480416 5:123969580-123969602 GGCTCTGGAACATCCCACAAGGG - Intergenic
998845689 5:146307514-146307536 GGGCTTGGGACCTACCACAAAGG - Intronic
1001922481 5:175611362-175611384 GAGTCTGGAACTAACCATCATGG + Intergenic
1003097701 6:3155682-3155704 GGATCTGGAGCCTGGCACCATGG - Exonic
1003377710 6:5594755-5594777 GGGGCTGGGACCCACCTCCAAGG + Intronic
1004587943 6:17020863-17020885 GGGTCTGGAACCCATCATAATGG - Intergenic
1004855979 6:19750383-19750405 GGGTATGTAACCTATCCCCATGG + Intergenic
1005002794 6:21259686-21259708 GTGGCTGGAACCTAGCACAATGG - Intergenic
1005987216 6:30882776-30882798 GGGTGTGGAATGTCCCACCAGGG + Intronic
1018322916 6:162632556-162632578 GGGTATGGATCCTATCACCCAGG - Intronic
1021796816 7:24263811-24263833 GAATCTGGAACCTTCCACCAGGG + Intergenic
1023998922 7:45178375-45178397 GGGTCTGGCAGCAGCCACCAGGG - Intronic
1027192829 7:76007526-76007548 GGCCCTGGAACCAACCTCCATGG + Intronic
1038952920 8:32435208-32435230 GGATCTGGAAGCTATCATCATGG + Intronic
1039270665 8:35876826-35876848 AGGTATGGAACCTACCACAGTGG + Intergenic
1042340608 8:67675084-67675106 GGGTATGGATCCTATCACCCAGG - Intronic
1043497498 8:80818390-80818412 AGGCCTGGAACCAACCCCCATGG - Intronic
1053272933 9:36762629-36762651 GGGTCTGACACCTACCTCCTGGG + Intergenic
1056998116 9:91483111-91483133 GCCTTTGGAACCCACCACCAGGG - Intergenic
1058726428 9:107808972-107808994 GGCTCTGAGACCTAACACCATGG - Intergenic
1062327333 9:136018480-136018502 GGGTCTGAAACCACCCACCCTGG + Intronic
1185458010 X:320032-320054 GGGGCTGGACCCAACCCCCAAGG - Intergenic
1192884339 X:75320775-75320797 GGGTCAGGAACCTTCCCTCAAGG - Intergenic
1197183427 X:123561840-123561862 GGACCTGGAACCCAGCACCATGG + Intergenic
1197718777 X:129730407-129730429 AGGTCTGGAATCTCCCACAAGGG + Intergenic
1199981022 X:152920572-152920594 AGGTCTGGCGGCTACCACCAGGG + Intronic