ID: 946681238

View in Genome Browser
Species Human (GRCh38)
Location 2:222218948-222218970
Sequence GCAGCTGAAAAGTTCAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946681238_946681239 8 Left 946681238 2:222218948-222218970 CCGGCTTTGAACTTTTCAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 946681239 2:222218979-222219001 ATCACTGTCTTGCAGAGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946681238 Original CRISPR GCAGCTGAAAAGTTCAAAGC CGG (reversed) Intronic
900532533 1:3161758-3161780 GCACCTGAACAGTCCTAAGCAGG + Intronic
901731165 1:11280891-11280913 GCCACTGAAGAGTTCTAAGCAGG - Intronic
901831317 1:11894305-11894327 GCAGCTGGAAGGCTCAAAGCAGG + Intergenic
902424942 1:16312886-16312908 GCAGGAGAAACGTTCAAACCTGG - Intronic
902801360 1:18832121-18832143 GCTGCTGGGAAGCTCAAAGCAGG - Intergenic
904393444 1:30200716-30200738 GCTGTTGAAAAGATCAAAGTTGG - Intergenic
904866992 1:33587165-33587187 TAAGCTGAAAAGATAAAAGCAGG + Exonic
906289130 1:44608482-44608504 ACAGCTACAAAGTTCAGAGCAGG - Intronic
906305162 1:44713398-44713420 TCAGCTGAGAAGTACAAAGCAGG - Intronic
908785591 1:67731707-67731729 GCTACTGAAAAATTTAAAGCGGG + Intronic
910205227 1:84742960-84742982 GCCACTGAAAAGTTCAAGGGTGG + Intergenic
910646929 1:89524639-89524661 GCAGCTGAAAAATTCACAGCAGG + Intergenic
912205788 1:107507932-107507954 GCAGAAGAAAAGTTTGAAGCTGG + Intergenic
913704745 1:121408516-121408538 CCAGCTCAGAGGTTCAAAGCAGG - Intergenic
915032147 1:152889885-152889907 GCAGAAGAAAAGTTTGAAGCTGG - Intergenic
920109931 1:203580691-203580713 GCCACTGAAAAGGTTAAAGCAGG - Intergenic
920202049 1:204265730-204265752 GCAGCAGAAAAGGGCAAAGCAGG - Intronic
921732190 1:218590989-218591011 GCTGTTGGAAAGTTCAGAGCTGG + Intergenic
922938133 1:229436604-229436626 GCACCTGAAAACTTAGAAGCAGG - Intergenic
924712968 1:246545848-246545870 GCAGCTGAGAAGTACAGAGCTGG - Intronic
1063034221 10:2269294-2269316 GCAGCTGAAATGTGCAGGGCAGG + Intergenic
1063962180 10:11315735-11315757 GCTGCTGGAAAAGTCAAAGCTGG - Intronic
1064295082 10:14071878-14071900 GCAGCTGAAAGGGTGAAAGAAGG + Intronic
1065421262 10:25547026-25547048 GCCACTGAAAGGTTCTAAGCAGG + Intronic
1066319447 10:34286795-34286817 GCAGGTGAAAAGGTGAAACCAGG + Intronic
1067194549 10:44104903-44104925 ACAGCTAAAAGATTCAAAGCAGG + Intergenic
1067801275 10:49361121-49361143 GCAGCTGAAAAGCCCATATCTGG + Intergenic
1068650045 10:59512611-59512633 TCAGATGAAAAGAGCAAAGCAGG + Intergenic
1069028673 10:63571990-63572012 GCATCTGATTAATTCAAAGCTGG + Intronic
1069938134 10:71933528-71933550 GCTGCAGAAAAGTTGGAAGCTGG - Intergenic
1072872311 10:99133119-99133141 GCCTCTGAAAAGTTCAAACTGGG + Intronic
1073899391 10:108202432-108202454 GAAACTGAAAAGTTGAAGGCGGG + Intergenic
1074968786 10:118518430-118518452 GCAGAGGAAAAGGTCAAAGTGGG - Intergenic
1074974446 10:118568705-118568727 CCATCTGAAAAGTTCATAGCCGG - Intergenic
1076196236 10:128520295-128520317 GCCGCTGTAAAGGTCTAAGCAGG - Intergenic
1076513477 10:131028964-131028986 GCAGAAGAAAAGTTTGAAGCTGG + Intergenic
1078426979 11:11259949-11259971 GCCACTGAAAAGTTGTAAGCAGG - Intergenic
1078643407 11:13116458-13116480 GCCTCTGAAAAGTTTTAAGCAGG - Intergenic
1079153079 11:17919244-17919266 GCAGCTGAGAGGTTATAAGCAGG + Intronic
1079862833 11:25695085-25695107 GCAGCTGGAAAGTGCAAAACTGG - Intergenic
1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG + Intronic
1081080190 11:38731856-38731878 GCAGCTGGGAAGTTCAAAATGGG - Intergenic
1083073966 11:60017955-60017977 GCAGCTAACAAGTACAATGCTGG - Intergenic
1087266023 11:96062362-96062384 GCAGGTAAAAAGTTCACAGCTGG + Intronic
1087386447 11:97475042-97475064 GCATCTGAGAAGATCTAAGCAGG + Intergenic
1087836922 11:102884794-102884816 GCAGCTGAGAAGGTGAAACCAGG + Intergenic
1091609735 12:1995713-1995735 TCAGCTGGAAAGATAAAAGCAGG - Intronic
1091756939 12:3059535-3059557 GCAGCATAAAAAGTCAAAGCTGG - Intergenic
1092449586 12:8589530-8589552 TCAGCTTAAAGGTTCAAAGGTGG - Intergenic
1092639901 12:10494249-10494271 GCAGCTTCAAAGATCAAAACTGG + Intergenic
1093575200 12:20719715-20719737 GCAGAAGAAAAGTTTGAAGCTGG + Intronic
1095065057 12:37762179-37762201 GCAGCTGGAAAGCTCAAACTGGG + Intergenic
1097078937 12:56415376-56415398 GGAGCTGGAAATTTCAAAGAGGG + Intergenic
1098135193 12:67394716-67394738 GCAGCTGAGAAGTTGAGAGCTGG + Intergenic
1099503090 12:83437582-83437604 GCAGAAGAAAAATTTAAAGCTGG - Intergenic
1099560666 12:84170631-84170653 GCAGCTGATTATTTCAAACCAGG + Intergenic
1100616009 12:96232268-96232290 GCCAATGAAAAGTTAAAAGCTGG + Intronic
1101346078 12:103887286-103887308 GCATCTGAACACTTCAAAGCTGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103005368 12:117416464-117416486 ACCGCAGAAAAGTTCAAAGTTGG - Intronic
1105258161 13:18758816-18758838 GCAGCTGAAAATGTAGAAGCAGG - Intergenic
1106265758 13:28108214-28108236 GCAGCTCATGAGTTCTAAGCAGG - Intergenic
1109984803 13:69965915-69965937 GCAGAAGAAAAGTACAAAGTTGG + Intronic
1110980489 13:81890513-81890535 GCACCTGAAAAGGGCAAACCAGG - Intergenic
1111483202 13:88859954-88859976 GCAGCTGAAATGCTCAGGGCTGG + Intergenic
1112723795 13:102278341-102278363 GCAGCGGACAAGTTGAAAACTGG + Intronic
1115453475 14:33575009-33575031 GCAGGAGGAAAGCTCAAAGCAGG + Intronic
1116433610 14:44873565-44873587 GCCGCTGGAAAGTTCAAACTGGG - Intergenic
1116881412 14:50173131-50173153 GCAGTTAAAAAGTTGGAAGCTGG - Intronic
1117474687 14:56082072-56082094 GAAGAGGAAAAGTTCAATGCAGG + Intergenic
1117970231 14:61244286-61244308 TCAGCTGAGGAGTGCAAAGCTGG + Intronic
1119827291 14:77668011-77668033 GCACCTTGGAAGTTCAAAGCAGG - Intergenic
1123438144 15:20270688-20270710 GCAGGTGAATCGTTCAAACCCGG - Intergenic
1124377049 15:29135002-29135024 GCTGCTGAGAAGCCCAAAGCAGG + Intronic
1125287664 15:38111187-38111209 ACTGCCAAAAAGTTCAAAGCAGG - Intergenic
1125870569 15:43097696-43097718 GCAGAAGAAAAGTTGGAAGCTGG - Intronic
1125875397 15:43139768-43139790 GCAGAAGAAAAGTTGGAAGCTGG + Intronic
1126391744 15:48163412-48163434 GCAGAAGAAAAGTTTGAAGCTGG + Intronic
1130736064 15:86550411-86550433 ACAGCTTAAAAGTTAAAAGATGG + Intronic
1131629433 15:94160853-94160875 GCAGCAGAAAGGTTGAAAACGGG - Intergenic
1132301059 15:100775804-100775826 GCAGCTGACAAGTGCAGAACTGG - Intergenic
1136251417 16:29008078-29008100 GCAGCTGAACAGTTCATGGGTGG - Intergenic
1137406905 16:48196406-48196428 GAAGCTGGAAAGTGAAAAGCTGG - Intronic
1140700808 16:77580033-77580055 GTAGGTGAAAAGTTCCAACCTGG + Intergenic
1141383797 16:83600788-83600810 TTAGCTGAAAAGTTCACAGGCGG + Intronic
1143317025 17:6040601-6040623 GCGGTTTAAAATTTCAAAGCTGG - Intronic
1144038383 17:11387335-11387357 GCAGGTGATGAGTTCAAGGCTGG + Intronic
1144542516 17:16158268-16158290 TCAGTTAAAAAGTTCAAGGCGGG - Intronic
1145113801 17:20189417-20189439 CCATTTGAAAAGTGCAAAGCAGG - Intronic
1146680652 17:34805364-34805386 GCAGGTGAGAAGTTCAGGGCTGG - Intergenic
1151027465 17:70695397-70695419 GCAGAAGAAAAGTTTGAAGCTGG + Intergenic
1152862720 17:82705220-82705242 GCAGCTGCAGAGTCCAAAGACGG + Intergenic
1153089019 18:1322700-1322722 GCAGTTGACAAGATCTAAGCAGG - Intergenic
1153494011 18:5679017-5679039 GCTCCTGAATAGTGCAAAGCAGG + Intergenic
1153803229 18:8689886-8689908 GCAGCTGAAATGTCACAAGCAGG + Intergenic
1154396751 18:13997809-13997831 GCAGCTGAACAGTTGAAAACAGG + Intergenic
1156587840 18:38452119-38452141 GCAACTGAAAAGTTCTAGGCCGG + Intergenic
1156741862 18:40340729-40340751 GGAGCAGCAAAGTTAAAAGCTGG + Intergenic
1156797074 18:41058860-41058882 GCAGTTGAAAAGTTACAAGCTGG - Intergenic
1158577927 18:58655963-58655985 GCAGAAGAAAAGGTAAAAGCAGG + Intergenic
1159214930 18:65379948-65379970 CTAGCTGAAATTTTCAAAGCAGG - Intergenic
1159342534 18:67154867-67154889 GCAGCTGGCAAGTTCAAGGTTGG + Intergenic
1160777124 19:861481-861503 GCAGCTGCAAAGGTCGAGGCTGG - Intronic
1164811274 19:31158431-31158453 GTAGGTGAGAAGTTCAATGCAGG + Intergenic
1165283110 19:34814870-34814892 TCATCTCAAAGGTTCAAAGCAGG - Intergenic
1166078800 19:40430253-40430275 GCAGGAGAATAGTTCAACGCGGG - Intergenic
924980709 2:217995-218017 GGAGCTGTAAAGTGCATAGCTGG + Intronic
925215499 2:2091855-2091877 GCAGAAGAAAAGTTTGAAGCTGG - Intronic
925730485 2:6917097-6917119 GCAGCTGCACAGCTCAACGCCGG + Intergenic
926223942 2:10954426-10954448 GCAGCATACAAGTTCAAAGAAGG + Intergenic
927036517 2:19183210-19183232 GCAGTTGAAAAGGACAAAGAGGG - Intergenic
927243904 2:20941656-20941678 GCAGCTGAGCAGATCAGAGCTGG - Intergenic
927300434 2:21506035-21506057 ACAGCTGAAAAGTTCAAGATTGG - Intergenic
928347138 2:30510427-30510449 GCTGCTGAGATGTTCAAAGCTGG + Intronic
929258429 2:39838930-39838952 GCAGCTGAAATGTTCAGATGGGG + Intergenic
930226072 2:48794789-48794811 ACAGCTGAAGAGTTTAAAGTGGG - Intergenic
930844144 2:55883346-55883368 ACAGCAGATAATTTCAAAGCAGG - Intronic
931895305 2:66722197-66722219 GCGGAAGAAAATTTCAAAGCTGG + Intergenic
932335929 2:70931423-70931445 GCTGCTAAAAACTTCAAACCGGG + Intronic
935540431 2:104341493-104341515 GCAGCTAAATTGTTGAAAGCTGG + Intergenic
935935407 2:108176968-108176990 GCAGCTGCAGAGTTCTAAACCGG + Intergenic
936098892 2:109557461-109557483 ATAGCTGAAAAGTAAAAAGCTGG + Intronic
938621355 2:133057631-133057653 GCAGAAGAAAAGTTTGAAGCTGG + Intronic
940038181 2:149331002-149331024 GGAGCTGCCAAGTTCAAGGCTGG + Intronic
940756602 2:157690045-157690067 GCAGAAGAAAAGTTTGAAGCTGG - Intergenic
942430890 2:175910272-175910294 GCAGCTGAAATGGAGAAAGCAGG - Intergenic
942492993 2:176508663-176508685 GCAGGTCAGAAGTTCAATGCGGG + Intergenic
942750874 2:179285674-179285696 GCAGATTAAATGTTAAAAGCAGG - Intergenic
946681238 2:222218948-222218970 GCAGCTGAAAAGTTCAAAGCCGG - Intronic
948278586 2:236728969-236728991 GCTGATGACAAGTTCAAAGTAGG - Intergenic
948573961 2:238937894-238937916 GTAGCTGAATGTTTCAAAGCTGG - Intergenic
1171267767 20:23786415-23786437 GCAGCTGAGCAGTTCCAAGTGGG + Intergenic
1171991410 20:31699390-31699412 GCAGCTGAGATGGTAAAAGCAGG + Intronic
1174497282 20:50956863-50956885 GCAGCTCAAAGGTACCAAGCTGG + Intronic
1178150117 21:29784913-29784935 GCAGCTGAAAAGCTCCATGTAGG + Intronic
1178740300 21:35193830-35193852 CCACCTGGAAAGTTCAATGCAGG - Intronic
1180139981 21:45887382-45887404 GCAGCTGAGCAGGGCAAAGCTGG - Intronic
1180867445 22:19127511-19127533 CCAGCTGTAAAGCTCAGAGCAGG - Intergenic
1182793137 22:32969674-32969696 ACAGCTGAAAGGTTCAGAGAGGG - Intronic
950453456 3:13078724-13078746 GCAGCTGGAGAGTTCACAGGAGG + Intergenic
950832678 3:15890742-15890764 ACAGCTGAAAAGTTCAAGATTGG - Intergenic
950838544 3:15944198-15944220 GCAGAAGAAAAGTTGAAAGCTGG + Intergenic
951176296 3:19604758-19604780 GCAGAGGAAAAGTTGGAAGCTGG - Intergenic
954936757 3:54333717-54333739 GTAGCTGAAAATTAAAAAGCAGG - Intronic
956098162 3:65739254-65739276 GCAGAAGAAAAGTTTGAAGCTGG - Intronic
956127853 3:66028002-66028024 TCAGCTGAAAATATCACAGCTGG + Intronic
956586323 3:70868878-70868900 GCAGCTGCAAATCTCAGAGCAGG - Intergenic
960966693 3:123110589-123110611 CCACCTGAACAGTTCAAAGATGG - Intronic
962799742 3:138880082-138880104 GCATGTGAGAAGTTCAATGCGGG - Intergenic
963671880 3:148261205-148261227 ACAGCTGAAAAATTCTGAGCAGG + Intergenic
964044671 3:152308707-152308729 ACAGCTGAAAATTTCAGAGAGGG - Intronic
964210430 3:154220683-154220705 GCCACCGAAAAGTTCTAAGCAGG + Intronic
967932233 3:194698460-194698482 CCAGCAGAAAAGGACAAAGCGGG + Intergenic
971164242 4:24166242-24166264 GCAGAAGAAAAGTCCGAAGCTGG + Intergenic
971654333 4:29322638-29322660 GCAGGTTAAAAGTTCAAAATAGG - Intergenic
971727544 4:30333082-30333104 TCAGCAGAAAAATACAAAGCAGG + Intergenic
972261048 4:37408409-37408431 GCCGCTGGAAAGTTCAAACTGGG + Intronic
975850815 4:78570331-78570353 GCCAGTGAAAAGTTCACAGCTGG + Intronic
977477996 4:97537538-97537560 GCAGCTGGGAAGTTCAAACTGGG + Intronic
977597023 4:98894538-98894560 GCAGAATAAAAGTTGAAAGCTGG - Intronic
979104787 4:116670261-116670283 ATAGCTGAAAAGTTAAAACCAGG + Intergenic
981391900 4:144200664-144200686 GCAGAAGAAATGTTTAAAGCTGG - Intergenic
981480110 4:145229689-145229711 GAAGATGAAAAGGTCAAAGATGG + Intergenic
982458906 4:155643511-155643533 GCAGAAGAAAAGTTGGAAGCTGG + Intergenic
983771788 4:171559261-171559283 GCACCAGAAATGTTCAAACCAGG - Intergenic
986506187 5:8454553-8454575 GCTGCAGAAAAGTTTAAAGCTGG + Intergenic
989061125 5:37412803-37412825 GAGGCTGAAGAATTCAAAGCGGG + Intronic
989408105 5:41084251-41084273 GCAGCTAAACAATTCAAAGGAGG + Intergenic
989973996 5:50560162-50560184 CCAGCTCAGAGGTTCAAAGCAGG + Intergenic
992271314 5:75066238-75066260 GCAGAAGAAAAGTTTGAAGCTGG + Intergenic
992462535 5:76974957-76974979 GCAGCTGAAAAACTGAAAACAGG + Intronic
994476110 5:100272440-100272462 GCAGAAGAAAAGTTAGAAGCTGG + Intergenic
996399507 5:123046349-123046371 GCAGCTGACCAGTGCAAAGCAGG - Intergenic
996550930 5:124729255-124729277 GCAGCTGTGAAGCTCAAAGACGG - Intronic
996819020 5:127605208-127605230 GAAGATGTAAAGGTCAAAGCCGG - Intergenic
997162960 5:131628445-131628467 GCAGAAGAAAAGTTTGAAGCTGG + Intronic
997695044 5:135854534-135854556 GCAGAAGAAAAGTTTGAAGCTGG - Intronic
998928676 5:147156314-147156336 GCAGCTGAAAATAGCAAAGGTGG + Intergenic
999202278 5:149824904-149824926 GCAGCTGAGTAGTTCGAAGGGGG - Intronic
999700172 5:154220681-154220703 GCAAGAGAAATGTTCAAAGCTGG + Intronic
1000430777 5:161149675-161149697 GCTGCTGAAAGGTTTTAAGCGGG - Intergenic
1001057041 5:168458290-168458312 ACAGCTGCTAAGTACAAAGCTGG + Intronic
1001626513 5:173140320-173140342 CCAGCTAAAAGGTTCAGAGCAGG + Intergenic
1001934123 5:175692634-175692656 GCAGCTGGAAAGTTCAGGGCAGG + Intergenic
1002498584 5:179632676-179632698 GCACCCGGAAAGTTCAAAACCGG - Intronic
1003049961 6:2771149-2771171 GCAGCTGCAGAGTCCACAGCAGG - Intronic
1004470186 6:15922090-15922112 GCAGAGGAAATGCTCAAAGCTGG + Intergenic
1005336064 6:24797807-24797829 TCAGCTGCAAAGTTCCCAGCAGG + Exonic
1006865061 6:37202545-37202567 GCAAGTGCAAAGTTCCAAGCAGG - Intergenic
1007266066 6:40596894-40596916 GGAGGTGAAAAGTTCAGAGTCGG + Intergenic
1008319239 6:50087074-50087096 GCAGCTGAATATTTGAAATCTGG - Intergenic
1009876005 6:69506531-69506553 GCAGCTCAAAAGTCCTAAGATGG + Intergenic
1011130473 6:84046982-84047004 GCTGCTGAAAAGAGCAAAGCTGG + Intronic
1011333672 6:86236891-86236913 GCCACTGAAAAGTTCAAACTGGG + Intergenic
1011740014 6:90350181-90350203 GCCGCTGAAAAGTTTTAATCAGG - Intergenic
1017308734 6:152952119-152952141 GCATTTGAAAAGGTCACAGCAGG + Intergenic
1018525747 6:164708404-164708426 GCAGCTGTGAAGTTCAAACTGGG - Intergenic
1019061035 6:169258426-169258448 GCAGAAGAAAAGTTCGAAGCTGG - Intergenic
1022665074 7:32403078-32403100 GCAGCTGATGATTTAAAAGCTGG - Intergenic
1022815464 7:33909830-33909852 ACAGCTTAAAAGTTTAAATCAGG - Intronic
1023363849 7:39443375-39443397 GCAGCGGAAAAGAGCAATGCGGG + Intronic
1025877163 7:65491788-65491810 CCAGCTGCAAAGTTCAAAGGAGG - Intergenic
1027380335 7:77601816-77601838 GCTACTGAAAAATTTAAAGCCGG + Intronic
1027720934 7:81740625-81740647 GGAGGTCAAAAGCTCAAAGCAGG + Intronic
1028525547 7:91781696-91781718 GCAGCTGAGATGTACAAAGAAGG - Intronic
1028600859 7:92598910-92598932 GCAGCTGAAAGCTTCAAGGTAGG - Intergenic
1029903499 7:104067346-104067368 GCTGATGAAAAGCTCAGAGCTGG + Intergenic
1030570960 7:111223731-111223753 GCAGCTGAAAATTTCATACCTGG + Intronic
1031664553 7:124468378-124468400 GCAGCTGGAAAGCTCAAACAGGG - Intergenic
1036117392 8:5972835-5972857 GCAGCTGAGAAGTTTTAAGATGG - Intergenic
1036562791 8:9911600-9911622 GCAGCTGACAAGTTAGAAGGGGG + Intergenic
1037645726 8:20791049-20791071 GCAGCTGAATCATTCAATGCCGG - Intergenic
1037964501 8:23123549-23123571 GCAGCTGAATTGTTAAAGGCAGG - Intergenic
1038191591 8:25326040-25326062 TCAGCTGAATAGTTCAAAGAGGG + Intronic
1039607709 8:38896335-38896357 GCAGTTTGAAAGGTCAAAGCAGG - Intergenic
1040355022 8:46608808-46608830 GCTGCTGAGAAGTTCAAACTGGG + Intergenic
1041310713 8:56513700-56513722 GCAGAAGAAAAGTACAGAGCTGG - Intergenic
1042070794 8:64931174-64931196 GCTGCTGAGAAGTTCAAACTGGG - Intergenic
1044282785 8:90375915-90375937 GCAGCTGAGAAGCTCAAACTGGG + Intergenic
1044507342 8:93037564-93037586 GTACCTGAAACATTCAAAGCTGG - Intergenic
1045841098 8:106582377-106582399 GCAGCTGAAAATAGCAAACCTGG + Intronic
1047202283 8:122777369-122777391 ACAGCTGATAAGTTAGAAGCAGG - Intergenic
1047588834 8:126304306-126304328 GCACCTGTAAAGTATAAAGCAGG + Intergenic
1048705003 8:137143764-137143786 GTAGCTGGAAAGTTCAAAATTGG - Intergenic
1051124827 9:13792027-13792049 GCAACTGCAAAGTTCAAACTGGG + Intergenic
1054754724 9:68946259-68946281 GTAGCTGCAAAGTTCACAGCAGG - Intronic
1054939004 9:70719764-70719786 GCAGTTAAAAAATTCAAAGAGGG + Intronic
1054940695 9:70737757-70737779 GCAGTTAAAAAATTCAAAGAGGG + Intronic
1057957923 9:99426015-99426037 GCAGCAGAAATATTCATAGCAGG - Intergenic
1058808983 9:108620664-108620686 GCACCTGAAAAGTACACAGTAGG + Intergenic
1058811037 9:108639760-108639782 GCAGCTGAAAGCTTCATAACTGG - Intergenic
1060738301 9:126080531-126080553 GTAGCTGAATGGTTCAGAGCTGG + Intergenic
1062036237 9:134383862-134383884 GGAGCTGGAAAGTTCAGAGGAGG + Intronic
1185753960 X:2637929-2637951 TGAGCTGAATAGTTCAAAACAGG - Intergenic
1187061739 X:15793140-15793162 GTAGCTGAAAATTTCAAGGGGGG - Intronic
1188096200 X:26026344-26026366 GCAGCTGAAAAATCAAGAGCTGG - Intergenic
1188228038 X:27626109-27626131 GGAGCTGAAAACTTAAAAGAAGG + Intronic
1188291411 X:28393164-28393186 GCAGAAGAAAAGTTGGAAGCAGG - Intergenic
1188342544 X:29022044-29022066 GGAGCTGAAAAGTCCAAAAAGGG - Intronic
1188813008 X:34675837-34675859 GCAAGTGAAAAGTTCAGAGGTGG + Intergenic
1192574311 X:72230548-72230570 GCAGCTCAACAGTTAAAGGCAGG - Intronic
1193906054 X:87245418-87245440 GCAGAAGAAAAGTTTAAAGCTGG + Intergenic
1194630472 X:96276534-96276556 GCAGCTAAAAAATACAAAGAGGG + Intergenic
1195419566 X:104658688-104658710 GCCACTGAAAAGTTTTAAGCAGG + Intronic
1197196246 X:123704320-123704342 CCAGCTAAAAAGCTAAAAGCTGG + Intronic
1197687407 X:129455799-129455821 GCAGAAGAAAAGTTTAAAGTTGG + Intronic
1198007024 X:132505434-132505456 GCAATGGAAAAATTCAAAGCTGG + Intergenic
1198751120 X:139937185-139937207 GCTACTGAAAAGTCCTAAGCAGG - Intronic
1199314465 X:146360932-146360954 GAAACTGAAAAGTTCAAACATGG - Intergenic
1199605497 X:149575157-149575179 GCTGATGAAAAATTCAAAGAAGG + Intergenic
1199633624 X:149794211-149794233 GCTGATGAAAAATTCAAAGAAGG - Intergenic
1201909020 Y:19114572-19114594 GCAGCTGGAAAGTCCAAACTGGG - Intergenic