ID: 946681348

View in Genome Browser
Species Human (GRCh38)
Location 2:222220189-222220211
Sequence GACAGCTTTGTGCCTCCGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946681348_946681353 10 Left 946681348 2:222220189-222220211 CCCGACGGAGGCACAAAGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 946681353 2:222220222-222220244 GAAAATCCATGCCTGGTGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 178
946681348_946681351 3 Left 946681348 2:222220189-222220211 CCCGACGGAGGCACAAAGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 946681351 2:222220215-222220237 ATAGCTGGAAAATCCATGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 124
946681348_946681355 14 Left 946681348 2:222220189-222220211 CCCGACGGAGGCACAAAGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 946681355 2:222220226-222220248 ATCCATGCCTGGTGCTGGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 435
946681348_946681352 9 Left 946681348 2:222220189-222220211 CCCGACGGAGGCACAAAGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 946681352 2:222220221-222220243 GGAAAATCCATGCCTGGTGCTGG 0: 1
1: 0
2: 2
3: 8
4: 154
946681348_946681354 11 Left 946681348 2:222220189-222220211 CCCGACGGAGGCACAAAGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 946681354 2:222220223-222220245 AAAATCCATGCCTGGTGCTGGGG 0: 1
1: 0
2: 4
3: 63
4: 745
946681348_946681358 21 Left 946681348 2:222220189-222220211 CCCGACGGAGGCACAAAGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 946681358 2:222220233-222220255 CCTGGTGCTGGGGAGGCAGTAGG 0: 1
1: 0
2: 8
3: 79
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946681348 Original CRISPR GACAGCTTTGTGCCTCCGTC GGG (reversed) Exonic
900669107 1:3838802-3838824 CTCAGCTCTGTGCCTACGTCAGG - Intronic
901017549 1:6240755-6240777 GACAGCCGTGTGGCTCCGTGTGG - Intergenic
903013448 1:20346480-20346502 AACATCTTTGTGCATCTGTCTGG + Intronic
907263718 1:53241193-53241215 CACAGTTCTGGGCCTCCGTCTGG - Intergenic
909305722 1:74074080-74074102 GTCAGCATTGTACCTCCTTCAGG - Intronic
916878881 1:168999547-168999569 GACAGCTTCCTGCCTCTCTCTGG + Intergenic
922036148 1:221850631-221850653 GACAGTTCTTTGCCTCCCTCGGG + Intergenic
923147897 1:231210482-231210504 GGCAGCTCTGTGCCTCTGCCCGG + Intronic
923315965 1:232780337-232780359 GACAGCTTTGTGTCTAACTCTGG + Intergenic
1062844456 10:693086-693108 AACAGCATAGTGCCTCTGTCTGG + Intergenic
1068755601 10:60648968-60648990 CACAGCTTTGTGCCTTCATAAGG - Intronic
1072495226 10:95950729-95950751 GACGGCTTTGTGGCTCCATCAGG - Intronic
1081534502 11:43987297-43987319 GACAGGTCTCTGCCTCCTTCTGG + Intergenic
1084499045 11:69524063-69524085 GACAAGTTTGTGCCTCCTTCTGG - Intergenic
1084893737 11:72250497-72250519 GAGAGCATTGTGCCCCTGTCTGG + Intergenic
1084974484 11:72789350-72789372 TACATCTTTGTTCCTCAGTCTGG + Intronic
1086584444 11:88434593-88434615 GACAGCTTTGGCCCTCTCTCTGG + Intergenic
1089190823 11:116651951-116651973 GACATCTTTGTGCCTGCCTCTGG - Intergenic
1092192082 12:6528551-6528573 GACAGCTTTCTGACTGCTTCTGG + Intronic
1092558797 12:9587390-9587412 AACAGATTTTTGCCTCCGTGGGG - Intergenic
1094035493 12:26065853-26065875 GAAATCTTTGTGCCTCTCTCAGG - Intronic
1103354883 12:120312399-120312421 GACAGCTTTGTGCCTCCCAAGGG + Intronic
1103433724 12:120908337-120908359 GACACCTTTGGGCCTCAGCCAGG + Intergenic
1104654066 12:130560126-130560148 AACACATTTTTGCCTCCGTCTGG - Intronic
1113416385 13:110131646-110131668 GACACCGTTGTGCCTGGGTCCGG - Intergenic
1121543996 14:94750442-94750464 CACAGCTGTGTGGCTCCCTCAGG - Intergenic
1130115840 15:81003208-81003230 GACATCTTGGCGCCCCCGTCGGG - Exonic
1131567158 15:93496715-93496737 GTCAGTTTTGTGCCCCCGCCCGG + Intergenic
1140222102 16:73051145-73051167 GACAGATTTGTGCACCCTTCCGG + Intronic
1152703803 17:81832907-81832929 GCCAGCCTTCTGCCGCCGTCGGG - Intronic
1154386398 18:13896326-13896348 GAAAGCTTTGTGCCAGGGTCAGG - Intronic
1157782770 18:50454788-50454810 GACAGCTTACTGCCTCCTTGCGG - Intergenic
1158772243 18:60533069-60533091 GACAGCTTTGTGTCTCCCCCAGG - Intergenic
1165825450 19:38703127-38703149 GACAGCTGTGTGTCTGCGGCTGG - Intronic
1165906149 19:39196158-39196180 GCCATCTTTGTGCCTCCCTGGGG + Intergenic
1166621922 19:44308997-44309019 TACAGCTTTGTGACTCCTTGTGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925076127 2:1017761-1017783 GACAGCTCTGTGACTGTGTCAGG + Intronic
928097848 2:28415656-28415678 GACATCTTTGTGCCCCCTTTAGG + Exonic
929115402 2:38439895-38439917 GACAGCTCTGGGCCACAGTCGGG - Intergenic
929452420 2:42046792-42046814 GGCAGCTTCCTGCCTCCCTCTGG - Intergenic
932875731 2:75449402-75449424 GACACCATTGTGCTTCAGTCTGG + Intergenic
937748608 2:125446302-125446324 GTCATCTTTGTGCCTCCTTGAGG - Intergenic
940191149 2:151041360-151041382 GACAGCTTTCTGACTCAATCAGG - Intronic
946681348 2:222220189-222220211 GACAGCTTTGTGCCTCCGTCGGG - Exonic
947597324 2:231421289-231421311 GACTGCTTTGTCCCTCGGTCAGG + Intergenic
948199759 2:236121084-236121106 GGCAGCTTTCTGCCTGCCTCTGG - Intronic
1175964502 20:62653720-62653742 GACACCTGTTTGCCTCCGTGGGG + Intronic
1176047830 20:63101837-63101859 GACAGCTGTGTGTGTACGTCCGG + Intergenic
1177211449 21:18076890-18076912 GGCAGCTCTGTTCCTCTGTCTGG - Intronic
1179240603 21:39587371-39587393 GACAGCTTTGTCTCTCTGGCAGG + Intronic
1183075689 22:35425418-35425440 GAAAGCTTGGTGCATCCGCCTGG + Exonic
1183190216 22:36317662-36317684 GACCGCTTTCTGCCTCTCTCCGG - Intronic
1184920088 22:47600001-47600023 GATCGCTCTGTGCCTGCGTCGGG - Intergenic
961344481 3:126254611-126254633 GACAGCTTTGTCCCACGATCAGG + Intergenic
962198798 3:133384753-133384775 GTCAGTTTTGTGGCTCTGTCAGG + Intronic
964918337 3:161863797-161863819 GGTAGCTTTGTGCATCCTTCAGG + Intergenic
967819946 3:193831285-193831307 TACACCTTTCTGCCTCCCTCTGG + Intergenic
968524978 4:1052125-1052147 AATAGCTTTGTGCCACTGTCTGG - Intergenic
982131622 4:152233875-152233897 GACAGCTATGTGCCTGGATCAGG - Intergenic
992360262 5:76030798-76030820 GAAAGGTTTGTGCCTCCCTCTGG + Intergenic
994767380 5:103935863-103935885 CACAGTTTTGTTCCTCAGTCTGG - Intergenic
999110713 5:149118673-149118695 GACAGCTTGAGGCCTCCCTCAGG - Intergenic
1000011490 5:157237581-157237603 GACAGTTTTGTGCCTTTGTAGGG + Intronic
1014138827 6:117917983-117918005 GACTGCTTATTGCCTCCTTCTGG - Intronic
1016128911 6:140441543-140441565 GTCATCTTTGTGCATCAGTCAGG + Intergenic
1016417505 6:143848546-143848568 TCCAGCTTTGTGCCTCCTCCTGG + Intronic
1016699375 6:147036696-147036718 GACAGATTTGAGCCTGGGTCCGG + Intergenic
1019161123 6:170067423-170067445 GGCGGCTTTGAGCCTCCTTCAGG + Intergenic
1020989008 7:15172241-15172263 GACAGCTCTGTACCTCTGCCTGG - Intergenic
1032478028 7:132225625-132225647 CACAGCTTTCTGCCTCCCTCTGG + Intronic
1035452383 7:158985829-158985851 GACATCTTTGTTCCTCCCACTGG + Intergenic
1038714684 8:29981137-29981159 GACATCTTTGTGACTCTGGCAGG - Intergenic
1043525953 8:81096834-81096856 GACAGCCTTGTGCCCCCAGCAGG - Intronic
1043877418 8:85501353-85501375 GACAGCTCTTTGTTTCCGTCTGG + Intergenic
1045391310 8:101717701-101717723 GGAAGCTTTGTGCCTTTGTCTGG - Intronic
1050603349 9:7274663-7274685 CACAGCTTTGTGCCTTCGTTTGG + Intergenic
1051173172 9:14340028-14340050 GACCTCTTTGGGCCTCAGTCTGG - Intronic
1055045244 9:71917428-71917450 GACAGCTTTCTGCCTAAATCAGG - Intronic
1056718407 9:89053106-89053128 GACAGCCCTGTGGCTCCTTCAGG - Intronic
1062025349 9:134337784-134337806 GACAGCAGTGCGCCTCCCTCTGG + Intronic
1062549492 9:137079356-137079378 CACAGCTACGTGCCTCCGACGGG + Exonic
1193508614 X:82372505-82372527 GACAGCTTTCTGCTTCCCTGAGG + Intergenic
1196389653 X:115193935-115193957 GAAAATTTTGTGCCTCTGTCAGG + Intronic
1200116638 X:153772452-153772474 GAGAGCTTCGTGCCTCAGACTGG - Intronic