ID: 946683271

View in Genome Browser
Species Human (GRCh38)
Location 2:222240118-222240140
Sequence CCCCGAGTGCCTGCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946683266_946683271 29 Left 946683266 2:222240066-222240088 CCAGGTTGGGGCTAATCAAAATA 0: 1
1: 0
2: 1
3: 19
4: 234
Right 946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG 0: 1
1: 0
2: 4
3: 31
4: 286
946683268_946683271 -6 Left 946683268 2:222240101-222240123 CCTGACACTCAACAACTCCCCGA 0: 1
1: 0
2: 1
3: 7
4: 81
Right 946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG 0: 1
1: 0
2: 4
3: 31
4: 286
946683267_946683271 -5 Left 946683267 2:222240100-222240122 CCCTGACACTCAACAACTCCCCG 0: 1
1: 0
2: 1
3: 9
4: 90
Right 946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG 0: 1
1: 0
2: 4
3: 31
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946683271 Original CRISPR CCCCGAGTGCCTGCTGCCCT GGG Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900666128 1:3816756-3816778 CCCCGCCAGCCTGCTGCCCACGG + Intronic
900933662 1:5752105-5752127 CCCTCAGCCCCTGCTGCCCTGGG - Intergenic
903340825 1:22653228-22653250 AGCCGAGAGCCTACTGCCCTCGG - Exonic
903392294 1:22972951-22972973 CTCAGAGTGCCTGCTGCCATGGG + Intergenic
903813294 1:26046525-26046547 CTCCGACTGGCGGCTGCCCTGGG + Intergenic
904422788 1:30404954-30404976 CCCTCAGAGCCTGCTGCTCTGGG + Intergenic
905933230 1:41804374-41804396 GCCCGTGTGCCTGCAGCACTGGG - Intronic
906701779 1:47864939-47864961 CCCTGACTGCCCTCTGCCCTAGG + Intronic
910655124 1:89610673-89610695 CCCCTGGAGCCTGCTGCCCTGGG - Intergenic
912564799 1:110580000-110580022 CCATGTGTGCCTGCTGTCCTAGG + Intergenic
914196593 1:145451044-145451066 TGCCGAGCTCCTGCTGCCCTGGG - Intergenic
915490956 1:156249856-156249878 GCCAGACTGCCTGCAGCCCTAGG + Exonic
915953231 1:160204305-160204327 GCCCAAGTTCCTGCTGCTCTGGG - Intergenic
916142678 1:161712958-161712980 CCTCAAGTCCCTGCTGCCATTGG + Intronic
918349014 1:183635226-183635248 ACCCGAGTGCCTGCCTGCCTCGG - Intronic
919919454 1:202159620-202159642 CCGAGACTGCCTTCTGCCCTGGG - Intronic
920839344 1:209540909-209540931 TCTAGAGTGCCTGCAGCCCTGGG - Intergenic
923098632 1:230794995-230795017 CCCAGTGGGACTGCTGCCCTTGG - Intronic
1064146946 10:12833283-12833305 CCCCGTGTGCCTGGTGTTCTCGG - Exonic
1064429498 10:15258617-15258639 CCCACAATGCATGCTGCCCTTGG + Intronic
1064971555 10:21072174-21072196 CTCCCAGTGGCTGCAGCCCTTGG + Intronic
1066649187 10:37639324-37639346 GCCCCAGAGCCTGGTGCCCTGGG + Intergenic
1067032051 10:42884730-42884752 GCCCCAGAGCCTGGTGCCCTGGG + Intergenic
1067102401 10:43342829-43342851 CCCCCAGTGCCTGCTGCGCTGGG + Intergenic
1067850575 10:49751436-49751458 CCCCCAGCCCCTGCAGCCCTGGG + Intronic
1067877552 10:50019173-50019195 CCCAGAGGTCCTGCTGCCCATGG + Intergenic
1071956904 10:90770250-90770272 CTCTGAGAGCCTGCTGCCCTGGG + Intronic
1072614515 10:97040414-97040436 CCCGGAGTGCCTGCTACTCCGGG + Intronic
1072658634 10:97348340-97348362 CTGCAAGTGACTGCTGCCCTTGG + Intergenic
1073444493 10:103572423-103572445 CCCCCAGTGCCTTCTGCTCCTGG - Intronic
1076575672 10:131465082-131465104 CCCTGTGTGCCTTCTGCCCTAGG + Intergenic
1077216777 11:1398332-1398354 CCCTGATTGGCTGCTTCCCTGGG + Intronic
1078146186 11:8723168-8723190 CCCAGTGTGGCTGCTGCCGTGGG + Intronic
1078465534 11:11547412-11547434 CCCCGAGTGCCTGGTCCCACAGG - Intronic
1078921645 11:15836310-15836332 CTCTGAGTTCCTGCTGCCCCAGG + Intergenic
1080184300 11:29461802-29461824 CCCCGAGTTCCTGCTCTCCCAGG + Intergenic
1080641229 11:34159708-34159730 CCCCCCTTTCCTGCTGCCCTGGG + Intronic
1081717512 11:45260895-45260917 CCCCTCTTGCCTTCTGCCCTGGG + Intronic
1083174648 11:60942032-60942054 CACCGTGTAGCTGCTGCCCTGGG + Exonic
1083199518 11:61111768-61111790 CCCCGAGGGTCTGCTGCCCTGGG + Intronic
1083891561 11:65598252-65598274 CCCCGAGCTCCAGCTGCCTTAGG - Exonic
1084432136 11:69116970-69116992 CCCCGTGGGCCGGGTGCCCTGGG - Intergenic
1084704891 11:70810429-70810451 CCCCGCATCCCTGCTGGCCTGGG - Intronic
1089223339 11:116894143-116894165 GCCAGAGGGCCTGCTGTCCTAGG - Intronic
1091395964 12:154398-154420 CTCTGAGTGCCTTCTGCCCCAGG - Intronic
1091841321 12:3623414-3623436 CCCCCAGTGTCTGCAGTCCTGGG - Intronic
1096462263 12:51828619-51828641 CCCCGTGGTCCTGCTGCCCTCGG + Intergenic
1097196923 12:57247746-57247768 CCCAGGGTGCCTGCAGCCTTTGG + Intronic
1097225711 12:57475892-57475914 CCACGAGTTCCTGCTGCAGTCGG - Exonic
1099574270 12:84361666-84361688 CCCCCACAGCCTGCTGCCCAGGG + Intergenic
1100089828 12:90955247-90955269 CCCCAATTGGCTGTTGCCCTGGG - Intergenic
1100476669 12:94941488-94941510 CCCCGATTGCTGGCTGCTCTTGG - Intronic
1102475442 12:113185555-113185577 TCGCCAGTGCCTGCGGCCCTCGG + Exonic
1104462870 12:128969615-128969637 CCCCGAGTGCCTCCGCACCTTGG - Intronic
1104892634 12:132147824-132147846 CCCCCAGTCCCTGCCTCCCTGGG - Intronic
1104929419 12:132329904-132329926 CCCGGAGGCCCCGCTGCCCTCGG - Intergenic
1106077852 13:26476271-26476293 CACCGCGTCCCTGCTGACCTCGG + Intergenic
1106327649 13:28709719-28709741 GCCCGAGTTCCTGCTGCACTTGG + Intronic
1111337525 13:86841498-86841520 TCCCTAGGGCCTGCTGCCCTGGG - Intergenic
1113167487 13:107458534-107458556 CCCTGAGGACCTGCTGCCCTTGG - Intronic
1113662192 13:112115142-112115164 CCCACAGTGCCAGCTGCCCCAGG - Intergenic
1113852182 13:113424122-113424144 CCCTGAATGCCTGCAGTCCTAGG + Intronic
1114360123 14:21962500-21962522 CCCCCAGTTCCTGCTCCCTTTGG - Intergenic
1114530371 14:23391670-23391692 AGCCGAGTTCCTGTTGCCCTTGG + Intronic
1117512956 14:56471510-56471532 GCCTGAGAGCCTCCTGCCCTAGG - Intergenic
1118837048 14:69484902-69484924 CCCCGAGTCCCTGCTGACCCCGG + Exonic
1118947286 14:70399322-70399344 CCACTGGAGCCTGCTGCCCTGGG - Intronic
1119323351 14:73744458-73744480 ACCCGAGGGCCCCCTGCCCTTGG + Intronic
1119615509 14:76096244-76096266 CCCTGGGTGCCTGTTGCCCTGGG - Intergenic
1122628339 14:103095659-103095681 CCCTGAGCCGCTGCTGCCCTCGG - Intergenic
1122774505 14:104111345-104111367 CCCCCAGTGACTCCTGCCCCAGG + Intronic
1124011930 15:25845747-25845769 CCCAGGGTGCATGCTGCCCTAGG + Intronic
1124785029 15:32671780-32671802 CCCCCAGTGCCTGGTGCCTGCGG + Intronic
1125749140 15:42016972-42016994 CCCAGGGTGCATGCTGCACTCGG - Intronic
1127997463 15:64161907-64161929 CACCGACTGCCTGTTGCCCTGGG - Intronic
1128061952 15:64740924-64740946 CCCCGAGTTCCCACTGCCCCCGG - Exonic
1128923671 15:71634577-71634599 CCCTGCGTGACTGATGCCCTGGG - Intronic
1129319685 15:74767695-74767717 CTCCTAGTCCCTGCTGCCCCAGG + Intergenic
1129457308 15:75682801-75682823 CCTCGGGTTCCTGCTGCCCACGG - Intronic
1129726478 15:77904144-77904166 CCTCGGGTTCCTGCTGCCCACGG + Intergenic
1129968013 15:79754028-79754050 CCCACAGTGCCTTCTGGCCTGGG + Intergenic
1130287971 15:82571342-82571364 ACCCGAGTGTGTGCTGCTCTGGG + Exonic
1131460700 15:92615667-92615689 CCCCCAGTGCCTGCTGTATTTGG - Intergenic
1131571522 15:93541946-93541968 CCACGAGTGCCTTCTCCCTTTGG - Intergenic
1131629561 15:94161811-94161833 CCCTGACTGCCTTTTGCCCTGGG + Intergenic
1132392737 15:101450718-101450740 CCCCCAGTGCCTTCTGGCCCGGG + Intronic
1132414096 15:101608395-101608417 CCCAGAAGGCCTTCTGCCCTGGG + Intergenic
1132419234 15:101651686-101651708 CGTCTAGTACCTGCTGCCCTGGG + Exonic
1132581220 16:685568-685590 CCCTGAGTGCGTGCTGCCGCAGG - Exonic
1132585379 16:703906-703928 CCCCTAGTGCCTACTGCTCCAGG + Intronic
1132600151 16:769556-769578 CCTCCTGTGCCTGCTGCACTGGG - Exonic
1132944619 16:2526143-2526165 CCCAGGCTGCCTGCTGACCTTGG + Intronic
1133207539 16:4242292-4242314 CCCCGAACCCCTGCAGCCCTGGG + Intergenic
1133744164 16:8674626-8674648 CCCCGAGTTCCGGCAGCGCTGGG - Intronic
1134169444 16:11956845-11956867 CCCCTAGTGCCTGGTACCCCTGG - Intronic
1135057317 16:19241651-19241673 CCACTAGAGCCTGCTGCCCTAGG - Intronic
1138281280 16:55773728-55773750 CCCTGATCACCTGCTGCCCTTGG - Intergenic
1138287259 16:55820133-55820155 CCCTGATCACCTGCTGCCCTTGG + Intronic
1138418802 16:56886364-56886386 CCCCCAGTGCCTGGTGCTCACGG + Exonic
1139529953 16:67538009-67538031 CCCCGAGCTCCGGGTGCCCTGGG + Intronic
1141382904 16:83591737-83591759 CACAGGCTGCCTGCTGCCCTGGG + Intronic
1141544530 16:84756043-84756065 CCCAGAGTTTCTGCAGCCCTTGG + Intronic
1141981083 16:87550873-87550895 CCCCCAGCGTCTGCAGCCCTGGG + Intergenic
1142386559 16:89768997-89769019 TACCGAGTGCCTGCTCCCCGAGG + Intronic
1142593792 17:1019841-1019863 CCCCAAGTACCTGCTCCCCTGGG - Intronic
1142865765 17:2790634-2790656 CACCTAGTGCCTGCTTCACTCGG + Intronic
1143141833 17:4745457-4745479 ACCCTAGTCCCTGCTGTCCTGGG + Intronic
1143619189 17:8071526-8071548 ACCCAAGAGGCTGCTGCCCTGGG - Intergenic
1143627987 17:8121939-8121961 CCGCGAGTGCCTGCTTCGCTTGG - Exonic
1144433155 17:15213671-15213693 CCCTGGGAGCCTCCTGCCCTGGG + Intergenic
1145038174 17:19555803-19555825 CCTCGAGTGCCTGCAGGACTGGG + Exonic
1145079048 17:19879524-19879546 CCCAGGGTGTCTGCTGACCTCGG + Intergenic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146143511 17:30389135-30389157 CCCCCAGAGCCCGCTGCCCTGGG - Intronic
1146278164 17:31528550-31528572 GCCCTGGTGCCTGCTGGCCTGGG - Intronic
1146844831 17:36175942-36175964 CCGGGGGAGCCTGCTGCCCTTGG - Intronic
1146857136 17:36263877-36263899 CCGGGGGAGCCTGCTGCCCTTGG - Intronic
1146863479 17:36324498-36324520 CCGGGGGAGCCTGCTGCCCTTGG + Intronic
1146873048 17:36387787-36387809 CCGGGGGAGCCTGCTGCCCTTGG - Intronic
1146880406 17:36438873-36438895 CCGGGGGAGCCTGCTGCCCTTGG - Intronic
1147066339 17:37925086-37925108 CCGGGGGAGCCTGCTGCCCTTGG + Intronic
1147075931 17:37988412-37988434 CCGGGGGAGCCTGCTGCCCTTGG - Intronic
1147077872 17:38004647-38004669 CCGGGGGAGCCTGCTGCCCTTGG + Intronic
1147087456 17:38067958-38067980 CCGGGGGAGCCTGCTGCCCTTGG - Intronic
1147093808 17:38128582-38128604 CCGGGGGAGCCTGCTGCCCTTGG + Intergenic
1147103400 17:38191921-38191943 CCGGGGGAGCCTGCTGCCCTTGG - Intergenic
1147147113 17:38491723-38491745 CCTGGAATCCCTGCTGCCCTGGG + Intronic
1147588214 17:41665262-41665284 CCTGGACTCCCTGCTGCCCTTGG + Intergenic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1148769112 17:50056724-50056746 TCCCAAGGGCCAGCTGCCCTGGG - Intronic
1149603852 17:57911155-57911177 CCCAGAGTTCCTGATTCCCTGGG + Intronic
1149847974 17:60018390-60018412 CCGGGGGAGCCTGCTGCCCTTGG - Intergenic
1150086329 17:62275007-62275029 CCGGGGGAGCCTGCTGCCCTTGG - Intronic
1150490816 17:65573188-65573210 GCCCCAGTGCCCGCTGCCTTGGG - Intronic
1151369583 17:73639433-73639455 CCCCGGGTGCCCCCTCCCCTAGG - Intronic
1151678479 17:75611914-75611936 CACCGAGTGCCTGCCGCCTGAGG + Intergenic
1152477231 17:80526307-80526329 CCCCGTGGCCCTCCTGCCCTGGG + Intergenic
1154221581 18:12459445-12459467 CTCAGAGTGCCTGCTGCACATGG + Intronic
1155251435 18:23956922-23956944 CCTGAAGTGCCTGCTGCCCAGGG - Intergenic
1157528840 18:48405635-48405657 CTTGGAGTGCCAGCTGCCCTAGG - Intronic
1157579129 18:48763278-48763300 CCCCAAGTGCCCCATGCCCTGGG - Intronic
1160261581 18:77299245-77299267 CCGCGAGTCCCTGCTGCTCAGGG - Intergenic
1160734898 19:658005-658027 CCCCCAGTGCGTGCTGCCCCCGG - Intronic
1161120680 19:2524165-2524187 CCCTGGGCCCCTGCTGCCCTGGG + Intronic
1161313944 19:3609190-3609212 CCCTGTGTGCCCCCTGCCCTGGG + Intergenic
1161613653 19:5257761-5257783 TCCCCAGAGCCTGCTGCCCACGG + Intronic
1161766442 19:6211402-6211424 CCCCCAATGCCAGCTGTCCTGGG - Intergenic
1162056341 19:8066218-8066240 CTCCGAGGCCCTGCTGACCTTGG - Exonic
1162475348 19:10896329-10896351 CCCCCAGATTCTGCTGCCCTGGG + Intronic
1162495332 19:11020150-11020172 CCATGACTGCCTGCTGGCCTTGG + Intronic
1165170559 19:33888975-33888997 CCCGGAGTGCCTTCTGACATGGG + Intergenic
1165754735 19:38286261-38286283 ACACGAGTGCCTGCTCCCCGGGG - Intronic
1166077227 19:40420883-40420905 CCCCGAGTGACTCCAGCCCCGGG - Intergenic
1167051213 19:47079911-47079933 TCCGGGGAGCCTGCTGCCCTAGG - Intronic
1167088192 19:47324693-47324715 CCCCCACTCCCTGCAGCCCTGGG + Intergenic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
925970950 2:9106177-9106199 CCCCAGGTACCTGCTGCCCCAGG + Intergenic
928987659 2:37196795-37196817 CCCCGGTTCCCTGGTGCCCTCGG - Intronic
934229455 2:90165181-90165203 CCCAGAGTGGCTGCTTTCCTGGG + Intergenic
934640313 2:96023840-96023862 CCCTGAGTGCCAGCTGCCCCAGG - Intronic
934793338 2:97081576-97081598 CCCTGAGTGCCAGCTGCCCCAGG + Intergenic
936014955 2:108950941-108950963 CCCCAACTGGCAGCTGCCCTTGG - Intronic
936056722 2:109267579-109267601 CCCCGAGTGCCGGCTGTGATGGG + Intronic
936624679 2:114135881-114135903 AGCAAAGTGCCTGCTGCCCTGGG + Intergenic
936876236 2:117193049-117193071 CCCCTAGTCCCTGCTGCCACAGG + Intergenic
937248066 2:120506244-120506266 CACAGGGAGCCTGCTGCCCTGGG - Intergenic
937904828 2:127047919-127047941 CCCCGAAGGCCCGCTGCCCTGGG - Intergenic
938138121 2:128775573-128775595 CCCAGAGTCCATGCTGCCGTGGG - Intergenic
938289916 2:130143649-130143671 CCCCCAGTCCCTGATGCCCACGG - Intronic
938694451 2:133822870-133822892 CCCCGGGTACCTGCAGCCCATGG + Intergenic
940566501 2:155368718-155368740 CCATAAATGCCTGCTGCCCTCGG - Intergenic
942714083 2:178871036-178871058 CCCAGAGGCTCTGCTGCCCTGGG - Intronic
945061071 2:205909376-205909398 CCCTCAGTGCCTGCTGTCTTGGG + Intergenic
945235383 2:207627246-207627268 CCCCGGGAGCCTGCTTCCCGCGG + Intergenic
946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG + Intronic
947665492 2:231902957-231902979 CCCCAACAGCCAGCTGCCCTTGG + Intergenic
947794185 2:232883947-232883969 ACCGGAGCGCCTGATGCCCTGGG + Intronic
947825876 2:233105709-233105731 CCACGATCACCTGCTGCCCTGGG - Intronic
948422689 2:237870260-237870282 CCCCGAGGGCCTGGTGACCCTGG + Intronic
948456651 2:238107598-238107620 CCCAGAGGTCCTGCTGCCCCAGG + Intronic
948665997 2:239535321-239535343 GCCCGCCTGCTTGCTGCCCTTGG - Intergenic
948930926 2:241131636-241131658 CCCCTACACCCTGCTGCCCTGGG - Intronic
1169275464 20:4230847-4230869 CCCCCAGTCCCTGCAGCCCCAGG + Intronic
1170737332 20:19023204-19023226 CCCAGAGTGCCTGCGTCCATGGG - Intergenic
1171346657 20:24470447-24470469 CCGCGACAGCCTGCAGCCCTGGG + Intronic
1172442820 20:34977927-34977949 CTTCCAGTGCCTGCTGCCTTGGG + Exonic
1173363610 20:42366111-42366133 CCACAAGGCCCTGCTGCCCTGGG - Intronic
1174264480 20:49321201-49321223 CCCCTCCTGCCTGCTCCCCTGGG - Intergenic
1175728010 20:61332563-61332585 GCCCTAGTGCCTGCTGCCCAGGG - Intronic
1175882959 20:62271145-62271167 CCTGGAATGCCTACTGCCCTTGG + Intronic
1178423264 21:32458871-32458893 CCCCGAGACCCTGGTGGCCTAGG + Intronic
1178679350 21:34659690-34659712 ACCAGAGTGCATCCTGCCCTGGG + Intergenic
1178833111 21:36072713-36072735 TCCTGAATGCCTGCTGCCCAGGG + Exonic
1179361547 21:40714115-40714137 CCCAGAAAGCCTGCGGCCCTGGG + Intronic
1179955063 21:44733969-44733991 CCCTGAGTCTCTGCTGCCCATGG - Intergenic
1180137343 21:45870460-45870482 CCCGGCCTCCCTGCTGCCCTAGG - Intronic
1181093301 22:20489079-20489101 CCCGGAGAGCCAGCAGCCCTCGG + Exonic
1181282014 22:21727070-21727092 CCTGAAGAGCCTGCTGCCCTGGG + Intronic
1181305921 22:21917264-21917286 CCGGCAGTGCCTGCTGCCCAGGG - Intergenic
1181568024 22:23751404-23751426 CCCCGAGTGCCGGCGGCTCGAGG - Intergenic
1181610081 22:24006345-24006367 GCCCGTGTGGCGGCTGCCCTTGG - Intergenic
1184560418 22:45259860-45259882 CCCCCATGGCCTGCGGCCCTAGG + Intergenic
1184653561 22:45930352-45930374 CCCCTAGGCTCTGCTGCCCTGGG + Intronic
1185176571 22:49330733-49330755 CCCAGGGTGCCTGCTGGTCTCGG - Intergenic
950366024 3:12484722-12484744 CCTCGTGCGCCTGCAGCCCTTGG + Exonic
950501036 3:13363973-13363995 CCCAGAATGCCTGCTGTGCTCGG + Intronic
950534461 3:13571115-13571137 CCCACAGCGGCTGCTGCCCTGGG + Exonic
950966489 3:17150192-17150214 CCCCAAATGCCTTCTGCCCCTGG + Intergenic
952305142 3:32138731-32138753 ACTCGAGTGCATGCTGCCCAGGG + Intronic
953653834 3:44832215-44832237 CCCTGACTGCCTGCTGTGCTTGG - Intronic
954417014 3:50398208-50398230 CCCCAAGTGCCTGTCCCCCTGGG + Intronic
955979742 3:64512820-64512842 CCCAGAGTGCCTGCTACCTCTGG + Intergenic
956892297 3:73624690-73624712 CGCCGGCTGCGTGCTGCCCTGGG - Exonic
957426856 3:80051079-80051101 CCTCCGGAGCCTGCTGCCCTAGG + Intergenic
961390961 3:126552076-126552098 CCCTGAGCCCCTGCAGCCCTGGG - Exonic
962430177 3:135311859-135311881 CCCCGAGGGCCTGCTGCCTATGG + Intergenic
963952259 3:151215826-151215848 CACTGAGTTCCTGCTGTCCTGGG + Intronic
964539383 3:157762209-157762231 CCTCAAGTCCCTCCTGCCCTTGG - Intergenic
968485374 4:858434-858456 GCCCCAGTGCCGGCTGCCCAGGG + Intronic
968569356 4:1331395-1331417 CCCCCACTCCCTGCTGCCCCGGG + Intronic
968685611 4:1956521-1956543 CCCCAAGAGCCTGCTGCACAAGG - Intronic
968728393 4:2258752-2258774 CCCCCTGTGCCTACTGGCCTGGG - Intronic
968961766 4:3749143-3749165 GCCCTGGTGCCTGGTGCCCTGGG + Intergenic
969298197 4:6281702-6281724 CGCTGAGCCCCTGCTGCCCTGGG + Intronic
969333705 4:6494629-6494651 CCGCGTGTGCTTGGTGCCCTGGG - Intronic
969368653 4:6716413-6716435 CGCCGCCTGCCTGCTGCCCGGGG + Exonic
969390539 4:6888921-6888943 CCACGAGTTCCTGGAGCCCTCGG + Intergenic
969754248 4:9137982-9138004 CCCAGAGAGTCTGCAGCCCTTGG - Intergenic
969814143 4:9674258-9674280 CCCAGAGAGTCTGCAGCCCTTGG - Intergenic
971727358 4:30331175-30331197 CCCCAAGTGGCTTCTGCCTTGGG + Intergenic
973101955 4:46283401-46283423 CACCGAATGCCTGATGCCCATGG + Intronic
974894840 4:67926711-67926733 CCCCCAGAGCCTGCCACCCTGGG + Intronic
979278139 4:118835989-118836011 CGCCTAGTGCCGGCAGCCCTCGG + Exonic
980480207 4:133377818-133377840 CCCTGAGTGCATTTTGCCCTTGG + Intergenic
984255216 4:177382144-177382166 CTCCCAGAGCCTCCTGCCCTGGG - Intergenic
985480817 5:109125-109147 CCACGGGTGTCTGCTGCCCACGG + Intergenic
985681533 5:1258305-1258327 CCCCATGCCCCTGCTGCCCTGGG + Intronic
986055134 5:4129287-4129309 CCCTGAGCCCCTGCTGCCCGTGG + Intergenic
987062771 5:14258302-14258324 CTCAGGGTGCCTGCTGCCCCAGG - Intronic
989691666 5:44152187-44152209 CCACGTGTGCCTGCAGCCTTTGG - Intergenic
992661443 5:78965451-78965473 CCCCTAGTCCCTCCAGCCCTAGG - Intronic
995014516 5:107294903-107294925 TTCCAAGTGCCTTCTGCCCTAGG + Intergenic
996605012 5:125311645-125311667 CCCCCAGTGACTGCAGCCCCAGG + Intergenic
999132855 5:149297827-149297849 CCCTGAGTGTCTGCCTCCCTTGG - Intronic
1001380956 5:171306388-171306410 CCCAGAGTGTCTGATGCCGTAGG + Exonic
1001691179 5:173633687-173633709 CCCAGAATGCCAGCTGCCCCGGG - Intergenic
1002198265 5:177512813-177512835 CCACGAGTACCTGCTGCTCAAGG - Exonic
1002301368 5:178259205-178259227 GCCAGTGTGCCTGCTGGCCTTGG + Intronic
1003167474 6:3693382-3693404 CCCCCACTGCCGCCTGCCCTCGG - Intergenic
1004707025 6:18134192-18134214 ACTCGAGGGCCTGCTGACCTTGG + Intronic
1004929132 6:20444910-20444932 CCCAGCATGACTGCTGCCCTAGG - Intronic
1005999731 6:30955651-30955673 CCCCGGCAGCCTCCTGCCCTCGG - Intergenic
1006902904 6:37514479-37514501 CCCAGAGTGCCTGCCTCCCTGGG + Intergenic
1007118640 6:39362342-39362364 CCCTGAGTAGCTGCAGCCCTGGG + Intronic
1007218597 6:40260861-40260883 CCCCAAGATCCTTCTGCCCTGGG + Intergenic
1010378597 6:75202755-75202777 CCCCCAGCGCTTGCCGCCCTGGG - Exonic
1018038965 6:159904919-159904941 CCCCAAGAACCTGCTGGCCTCGG + Intergenic
1018055268 6:160046989-160047011 CCCAGTGTTCCTGCTGCCGTTGG + Intronic
1018662880 6:166104796-166104818 CCCCACAAGCCTGCTGCCCTGGG + Intergenic
1019079199 6:169418039-169418061 GCCAGAGGCCCTGCTGCCCTGGG - Intergenic
1019140146 6:169937730-169937752 CCCAGAGTCCCTGCTGCTCCAGG - Intergenic
1019346550 7:533611-533633 GGACGAGTGCCAGCTGCCCTGGG - Intergenic
1019406533 7:887034-887056 CTCCTAGTCCCTGCTGCTCTGGG + Intronic
1019737637 7:2658587-2658609 CCTTGAGTGCCTCCTGCCCCAGG + Intronic
1020171936 7:5851613-5851635 GCCCGATTTCCTGCTGCCCTTGG - Intergenic
1020213183 7:6170471-6170493 ACCCGAGGGGCTGCTGCCATGGG + Intronic
1022094440 7:27130196-27130218 CCCCGCGTGCCCGCTGCTCTTGG - Exonic
1023864048 7:44230452-44230474 GCCCCAGTGCCTGGTGCCCTGGG + Intronic
1024250518 7:47502566-47502588 CCCTCATCGCCTGCTGCCCTGGG - Intronic
1028417669 7:90596743-90596765 CCCCCAGCGCCCGCTCCCCTCGG + Intronic
1028590265 7:92485578-92485600 CCCAGAGTGTCTGGTGCCCTTGG - Intergenic
1029086739 7:98017949-98017971 GCCTGATTTCCTGCTGCCCTTGG + Intergenic
1029110727 7:98211932-98211954 CCCAGAGTGCCTCCTGAGCTCGG - Intronic
1029702875 7:102259178-102259200 CCCCCAGTGCCAGGTGCCCTCGG + Intronic
1032121527 7:129160457-129160479 GCCCCAGTGCCTACTTCCCTTGG - Intronic
1032387270 7:131533478-131533500 GCCCGTCTGCCTGCTTCCCTGGG + Intronic
1034210569 7:149358878-149358900 CCCCCGGAGCCTGCTGCCCTGGG - Intergenic
1034343108 7:150370312-150370334 CACCCACAGCCTGCTGCCCTCGG - Intronic
1034392277 7:150795946-150795968 CCCCGAGTGCTTTTTGCCCCTGG - Intronic
1034450484 7:151134616-151134638 CCCAGAATGCCTGCTTGCCTTGG - Intronic
1035061042 7:156069893-156069915 CACCAAATGCCTGCTGACCTTGG + Intergenic
1035159962 7:156943265-156943287 CCCTGAGTGGCTGCTGTGCTGGG - Intergenic
1035534862 8:383309-383331 CCCTGCGTTCCTGCTTCCCTGGG - Intergenic
1036218834 8:6903611-6903633 CCCTGGGTCCCTGCTGCCCCTGG - Intergenic
1036682587 8:10886309-10886331 CCCAGAGCCCCTTCTGCCCTCGG - Intergenic
1037907363 8:22723450-22723472 CCCCGAGAGACTCCCGCCCTGGG + Intronic
1039725750 8:40214460-40214482 CCATCAGGGCCTGCTGCCCTGGG + Intergenic
1041010846 8:53542143-53542165 CAACCAGAGCCTGCTGCCCTTGG + Intergenic
1045358105 8:101407015-101407037 CCCTGAGTGCCTGCTGTCCGTGG - Intergenic
1048857841 8:138699174-138699196 CCCTAAGTCCATGCTGCCCTAGG + Intronic
1049601442 8:143509604-143509626 CGCCCAATGCCTGCTGCTCTGGG + Intronic
1049705252 8:144039255-144039277 CCCTGAGAGCCTGCTTTCCTTGG - Intronic
1049804601 8:144533190-144533212 CCCCGAGCGCCAGCTGCCCTGGG - Exonic
1049842179 8:144779745-144779767 CCTCTACTGCCTGCTGCCCTCGG + Intronic
1051855324 9:21559282-21559304 CCCGGAGCGCCGGCCGCCCTTGG - Intergenic
1053316358 9:37055188-37055210 CCCCCAGTGCAGGCAGCCCTGGG - Intergenic
1053321350 9:37101556-37101578 CCCCCAGTGCAGGCAGCCCTGGG - Intergenic
1056773464 9:89496169-89496191 CCCTGAGTGCCTGGGGTCCTGGG - Intronic
1057064648 9:92037600-92037622 TCCAGAGTGCTTCCTGCCCTGGG - Intronic
1057242490 9:93423637-93423659 CCCCCAGCCACTGCTGCCCTTGG - Intergenic
1057283029 9:93726355-93726377 CCTGGAGTGCCAGCTGCCCCAGG - Intergenic
1057397403 9:94692379-94692401 CCCCCAGAGCCTTCTGCTCTAGG - Intergenic
1060527484 9:124328607-124328629 CCCCGAGTGCCTGCGGCAAGCGG + Intronic
1060741095 9:126097996-126098018 AGCCGGGTGCCGGCTGCCCTAGG - Intergenic
1060947503 9:127578879-127578901 CCCCGTGTGCCTTGTGTCCTGGG + Intronic
1061080074 9:128364778-128364800 CCCGGAGGTCCAGCTGCCCTCGG + Intergenic
1061413213 9:130432101-130432123 CCCAGAGTGCCCACTGCCCACGG - Intronic
1061520541 9:131114890-131114912 CCCTGAGTGTCTCCAGCCCTGGG - Intronic
1061710045 9:132481172-132481194 CCCCAAGCTACTGCTGCCCTTGG + Intronic
1061875146 9:133539868-133539890 ACCCGGGTACCTGCCGCCCTGGG + Exonic
1062698139 9:137885790-137885812 TGCCGAGCTCCTGCTGCCCTGGG + Intronic
1185507512 X:641901-641923 CCCCGAGTGCCCGAGGGCCTGGG + Intronic
1188743323 X:33811558-33811580 CCCAGACTGCATCCTGCCCTAGG - Intergenic
1192234408 X:69286547-69286569 TCCCAAGGGCCTGCTTCCCTAGG + Intergenic
1194227549 X:91279769-91279791 CCCTGTGTGCCTGCAGCCTTTGG + Intergenic
1194239136 X:91422501-91422523 TCCCAAGTGCCTGAGGCCCTTGG + Intergenic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic
1195998790 X:110759333-110759355 CTCCTGGTGCCTGCTGCCCATGG + Intronic
1200080293 X:153572850-153572872 CCCCCTGTGCCTGCTGCCCTTGG - Intronic
1200086961 X:153611656-153611678 CCCCAGCTGCCTTCTGCCCTGGG - Intergenic
1201724816 Y:17140167-17140189 CCTCCAGGGCCTCCTGCCCTAGG - Intergenic