ID: 946689850

View in Genome Browser
Species Human (GRCh38)
Location 2:222301744-222301766
Sequence CTGGACTCCCATCCAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946689850_946689865 30 Left 946689850 2:222301744-222301766 CCCGCAGCTGGATGGGAGTCCAG 0: 1
1: 1
2: 0
3: 20
4: 203
Right 946689865 2:222301797-222301819 AGGAGTCCTGGTGCCAAATTTGG 0: 1
1: 0
2: 3
3: 11
4: 110
946689850_946689856 3 Left 946689850 2:222301744-222301766 CCCGCAGCTGGATGGGAGTCCAG 0: 1
1: 1
2: 0
3: 20
4: 203
Right 946689856 2:222301770-222301792 ACTTCCCTATCCGCAGCCGGTGG 0: 1
1: 0
2: 0
3: 5
4: 42
946689850_946689857 4 Left 946689850 2:222301744-222301766 CCCGCAGCTGGATGGGAGTCCAG 0: 1
1: 1
2: 0
3: 20
4: 203
Right 946689857 2:222301771-222301793 CTTCCCTATCCGCAGCCGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
946689850_946689860 10 Left 946689850 2:222301744-222301766 CCCGCAGCTGGATGGGAGTCCAG 0: 1
1: 1
2: 0
3: 20
4: 203
Right 946689860 2:222301777-222301799 TATCCGCAGCCGGTGGGCCAAGG 0: 1
1: 0
2: 1
3: 3
4: 60
946689850_946689854 0 Left 946689850 2:222301744-222301766 CCCGCAGCTGGATGGGAGTCCAG 0: 1
1: 1
2: 0
3: 20
4: 203
Right 946689854 2:222301767-222301789 GCCACTTCCCTATCCGCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 93
946689850_946689862 18 Left 946689850 2:222301744-222301766 CCCGCAGCTGGATGGGAGTCCAG 0: 1
1: 1
2: 0
3: 20
4: 203
Right 946689862 2:222301785-222301807 GCCGGTGGGCCAAGGAGTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946689850 Original CRISPR CTGGACTCCCATCCAGCTGC GGG (reversed) Intronic
900620068 1:3582672-3582694 TTAGACCCCCATCCAGCTCCTGG + Intronic
901378829 1:8859269-8859291 CTGGAGTTCCAGCCTGCTGCTGG + Intergenic
901735888 1:11311927-11311949 GTGGACTCCAGTCCTGCTGCTGG + Intergenic
902229911 1:15021440-15021462 CTGGACTCCCCTTCAGAGGCTGG + Intronic
903217135 1:21849409-21849431 CTGGTCTACCACCCCGCTGCTGG - Intronic
903217374 1:21850647-21850669 CTGGTCTACCACCCCGCTGCTGG - Intronic
903586163 1:24416778-24416800 CCGGACTCCCACCCAGCTGAGGG + Intronic
904145961 1:28391474-28391496 CTCCACTCCCACCCAGCTCCTGG - Intronic
904789988 1:33012478-33012500 CTGGACTTCTAATCAGCTGCTGG + Intronic
905878932 1:41451050-41451072 CTGGCCTCCCCTCCCTCTGCCGG + Intergenic
906380441 1:45328961-45328983 CTGAACTCCCAGCCAGCCCCGGG - Intergenic
906556118 1:46715917-46715939 CTGGACTCCTTTCCAGGTTCTGG - Intronic
906614837 1:47226812-47226834 CTGGACTCCCATCCAAGAGCAGG + Intronic
907425269 1:54375536-54375558 CTGGAGTCACAGTCAGCTGCTGG - Intronic
908355018 1:63320225-63320247 CTGGACTCCCTCCACGCTGCTGG - Intergenic
909591630 1:77355769-77355791 ATGGGCTCCAAGCCAGCTGCTGG - Intronic
910684850 1:89905749-89905771 CTGGACTCCTCTCCTGCTGGGGG - Intronic
916056083 1:161069692-161069714 ATGGGATCCCAGCCAGCTGCTGG + Exonic
919646332 1:200098561-200098583 CTGGATTCCCATCCTGTTTCTGG + Intronic
923098078 1:230791401-230791423 TTGTACTCCCATACTGCTGCTGG - Intronic
924141117 1:241024401-241024423 TTGTACTTCCATTCAGCTGCAGG - Intronic
1062959423 10:1561638-1561660 CTGGTCCCCCATGCAGCTGCTGG + Intronic
1065584994 10:27209175-27209197 CTGGACTCCCAAACTGCTGTGGG + Intronic
1071173961 10:82901551-82901573 CTCCACTCCCATCCAGCTCTAGG + Intronic
1071312213 10:84353555-84353577 CTGCAGCCCCATTCAGCTGCAGG + Intronic
1073600067 10:104838171-104838193 CTTGAATCCCCTCCAGCTGATGG - Intronic
1073931213 10:108578987-108579009 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1074529135 10:114285038-114285060 TTGCACGCCCTTCCAGCTGCTGG + Intronic
1074755117 10:116618759-116618781 TAGAGCTCCCATCCAGCTGCTGG + Intergenic
1077425326 11:2473385-2473407 CTGGAGTCCCGTCCAGCAGGAGG + Intronic
1077579384 11:3407175-3407197 CCTGACTCCCATCCAGGAGCCGG - Intergenic
1078644868 11:13131692-13131714 CTAGACTCCCAACCACCTACAGG - Intergenic
1081587629 11:44398275-44398297 TTGAAATCCCATCCAGCAGCGGG + Intergenic
1084305138 11:68277667-68277689 CTGAACTCCCATAGAGTTGCTGG + Intergenic
1084473040 11:69374380-69374402 CTGGACTCACCTCCATCTGGGGG + Intergenic
1085726783 11:78961561-78961583 CTGAAGCCCCAGCCAGCTGCAGG - Intronic
1088812293 11:113399946-113399968 CTGGACACCCCTCCACCTGGCGG + Exonic
1090500372 11:127255153-127255175 CAAGACTCCAATCCAGCTCCTGG + Intergenic
1090802001 11:130178852-130178874 CTGCAGACCCAGCCAGCTGCTGG - Intronic
1092913104 12:13165551-13165573 CAGGGCTGCCATCCAACTGCTGG - Intergenic
1095640198 12:44478341-44478363 CGGGACTCTCATCCAGCTTTTGG - Intergenic
1101409722 12:104458050-104458072 CCGGGCTCCCAGCCTGCTGCAGG - Intronic
1101527042 12:105540334-105540356 CTGGACTCCTCTACAGCTGGTGG + Intergenic
1104057366 12:125240692-125240714 CTGGACTCCCATCTCTCTTCCGG + Intronic
1104580679 12:130008867-130008889 CTGGACTCCTGTCCTGCCGCGGG - Intergenic
1105619295 13:22051624-22051646 CTGCACTCCAGCCCAGCTGCAGG - Intergenic
1105844028 13:24279505-24279527 CTGGGTTCCCATCCAGCTTCGGG - Intronic
1105900531 13:24748013-24748035 CTGGACTTCCCTCCCGCTCCGGG + Intergenic
1106356640 13:28989761-28989783 CTGCAGTCCCATGCAGCAGCTGG - Intronic
1107092716 13:36499692-36499714 CTGGACAACCCTCCATCTGCAGG + Intergenic
1109198887 13:59409415-59409437 CTGGATTTCCTCCCAGCTGCAGG + Intergenic
1113862486 13:113497359-113497381 CTGGTCTCACACACAGCTGCAGG - Intronic
1114586172 14:23816033-23816055 CTGTACTCCCACCCAGCTACTGG - Intergenic
1117304331 14:54459229-54459251 CTTGACTTCCATGCACCTGCAGG - Intergenic
1117411934 14:55457960-55457982 CAGGTCTCCCCTCCAGCTTCTGG + Intergenic
1119331835 14:73800655-73800677 CTGGAGTCCTTTCCTGCTGCAGG + Intergenic
1120865665 14:89293463-89293485 CTGGCCTCCCTCGCAGCTGCTGG + Intronic
1122050940 14:99059268-99059290 CTGGATTCCCTACCAGCTGCAGG - Intergenic
1122254568 14:100467418-100467440 CAGGACTCCCACCCGGCTGCAGG + Intronic
1122490407 14:102111425-102111447 CTTGACTTCCATGCACCTGCAGG - Intronic
1123757909 15:23411334-23411356 CTGGACACATATCCAGCTCCTGG - Intergenic
1124226252 15:27897518-27897540 CTTGACTTCCATGCACCTGCAGG - Intronic
1126256078 15:46627307-46627329 CTGGACTTCTATGCACCTGCAGG - Intergenic
1128352151 15:66898204-66898226 CTGGCCTCCATCCCAGCTGCAGG - Intergenic
1128808897 15:70555694-70555716 CTGGCCACCCTGCCAGCTGCTGG + Intergenic
1129322848 15:74784146-74784168 CTGGGCTCCCTTGGAGCTGCTGG + Intronic
1129800311 15:78408905-78408927 CTGTTCTCCCATCCAGCTCATGG + Intergenic
1131341277 15:91603767-91603789 CTGGACTTGGCTCCAGCTGCTGG + Intergenic
1131679051 15:94702396-94702418 GTGGCCTGCCATCCTGCTGCAGG - Intergenic
1132457218 16:30813-30835 CTGGACTGTCATCCTGTTGCGGG - Intergenic
1132710709 16:1265904-1265926 CTGGTCCCCCACCCAGCTGCCGG + Intergenic
1133751642 16:8730531-8730553 CAGGCCTCCCCTCCAGCTGTGGG + Intronic
1134041984 16:11076062-11076084 CTAGAATCCCCACCAGCTGCAGG - Intronic
1137753457 16:50883657-50883679 ATGGCCTCTCATCCAGCAGCAGG - Intergenic
1138124616 16:54428601-54428623 CAGGACATCCCTCCAGCTGCTGG - Intergenic
1138599633 16:58046934-58046956 CTGCACGCCCTTCCAGCTGGAGG - Intergenic
1140261360 16:73383258-73383280 CTGGCCACCCATCCAGCAGCAGG + Intergenic
1140428764 16:74883817-74883839 CTGGAATGCCATCCACATGCTGG + Intronic
1140479395 16:75254225-75254247 CTAGATTCCCTTCCTGCTGCAGG - Intronic
1142836900 17:2593944-2593966 CTTCACTCCCATCCACCGGCGGG - Exonic
1143996754 17:11013083-11013105 CTGCACTACCATCCATCTGGTGG + Intergenic
1145101628 17:20081920-20081942 CTGAACGGCCAGCCAGCTGCAGG - Intronic
1145818862 17:27815849-27815871 ATGGACTCCCATCTGGCTACAGG + Intronic
1146056400 17:29583482-29583504 CTGGCCTCCCACGCTGCTGCAGG - Exonic
1148747996 17:49929117-49929139 CTTGAGACCCACCCAGCTGCAGG - Intergenic
1149994409 17:61399371-61399393 CTGGCCTCCGACCCAGCTCCGGG - Intergenic
1151468224 17:74301505-74301527 CTGGACTCCAACCCAGGTCCTGG + Intronic
1151829991 17:76543882-76543904 CGTTGCTCCCATCCAGCTGCAGG - Intronic
1151988838 17:77561163-77561185 ATGAACACCCAACCAGCTGCCGG + Intergenic
1151988900 17:77561534-77561556 ATGGACACCCAACCACCTGCCGG + Intergenic
1151988951 17:77561852-77561874 ATGGACACCCAACCACCTGCCGG + Intergenic
1151989009 17:77562223-77562245 ATGGACACCCAACCACCTGCCGG + Intergenic
1151989071 17:77562594-77562616 ATGGACACCCAACCTGCTGCTGG + Intergenic
1151989095 17:77562753-77562775 ATGGACACCCAACCACCTGCCGG + Intergenic
1151989111 17:77562869-77562891 ATGGACACCCAACCAGCTGCTGG + Intergenic
1152363089 17:79841325-79841347 CTGTACACCCACCCAGCTTCTGG - Intergenic
1152940795 17:83172165-83172187 CTGGCCCCCCATCCAACTCCAGG - Intergenic
1152961210 18:81575-81597 CTGGACTGTCATCCTGTTGCAGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160875591 19:1295027-1295049 CTGGACACCCACCTCGCTGCTGG + Intronic
1162917477 19:13882116-13882138 CTGGGCGATCATCCAGCTGCAGG - Intergenic
1163683509 19:18697086-18697108 CTGGACCCCCATCCAGCTGCTGG - Intronic
1166500727 19:43339178-43339200 CTGGAGTCCCTTCCAACTGCTGG - Intergenic
1166509364 19:43394227-43394249 CTGGAGTCCCTTCCAACTGCTGG + Intergenic
1166857756 19:45791817-45791839 CTAGAATCCCATTCAGCTTCTGG + Intronic
1167649384 19:50721143-50721165 CTGGGTTCCCCTCCAGCTGCAGG + Intergenic
1168074054 19:53969559-53969581 CTGGATTCAAATCCAGATGCTGG - Intronic
1168137246 19:54359986-54360008 CTGTAATCCCCTCCAGCTGAGGG + Intronic
1168160831 19:54509099-54509121 CTGTAATCCCCTCCAGCTGAGGG - Intronic
924995731 2:358939-358961 CTGGGTTCTCATCCACCTGCAGG + Intergenic
926219567 2:10925661-10925683 GTGGACTCCTATCAAGCTGTCGG - Intergenic
927786291 2:25977492-25977514 CTCTACTCCCAGCAAGCTGCAGG + Intronic
928025846 2:27737989-27738011 CTGGGCTCCCAGCCGGCTGGAGG + Intergenic
928223570 2:29426093-29426115 CTGGCATCACATCCAGCTGTAGG - Intronic
928404953 2:31007637-31007659 CTGGATTCCTATCCAGTTACCGG - Intronic
932335213 2:70927269-70927291 CAGGACTCCCCTCCTGCAGCTGG + Intronic
936288777 2:111201534-111201556 CTGGTCTTCCCTCCAGCAGCTGG - Intergenic
936861960 2:117029638-117029660 TTGGAATTCCAGCCAGCTGCCGG + Intergenic
940908310 2:159188457-159188479 CTGGAGTCCCATCCAGCCAGTGG + Intronic
942447239 2:176086108-176086130 CTGGACTCCCACCGCGCTGATGG - Intergenic
943782267 2:191837570-191837592 CAGCACTCTCCTCCAGCTGCCGG + Intronic
944477250 2:200119473-200119495 ATGGATTCCCAAACAGCTGCAGG + Intergenic
944539745 2:200743915-200743937 CTGGACACCCGTCCATGTGCTGG - Intergenic
944659541 2:201909931-201909953 CTGGGCTCAGATACAGCTGCAGG - Intergenic
945713465 2:213329990-213330012 CTTGACTTCCATGCACCTGCAGG - Intronic
946689070 2:222297508-222297530 CTAGACTCTCTACCAGCTGCAGG - Intronic
946689850 2:222301744-222301766 CTGGACTCCCATCCAGCTGCGGG - Intronic
948050886 2:234978522-234978544 CTGGGCTCCTTTCCTGCTGCAGG + Intronic
1169512141 20:6275841-6275863 CTGGACTCAAATTCAGCTGTGGG + Intergenic
1170938104 20:20827116-20827138 TGGAACTCCCAGCCAGCTGCAGG + Intergenic
1173883972 20:46440515-46440537 CTGAGGTCCCATCCAGGTGCAGG + Intergenic
1174396424 20:50249879-50249901 CTGGACTGCCCTCCTGCTTCCGG + Intergenic
1175608315 20:60329618-60329640 CTGGTCACCCACCCATCTGCTGG - Intergenic
1178518201 21:33266313-33266335 CCGGGCTCCCACCCCGCTGCAGG - Intronic
1180787460 22:18554792-18554814 CTGGCCCTCCCTCCAGCTGCTGG - Intergenic
1180856909 22:19053172-19053194 CTGGACCCAACTCCAGCTGCAGG + Intronic
1181234280 22:21440513-21440535 CTGGCCCTCCCTCCAGCTGCTGG + Intronic
1181244368 22:21494318-21494340 CTGGCCCTCCCTCCAGCTGCTGG - Intergenic
1181650908 22:24258640-24258662 CTGGGCTCCCCCGCAGCTGCCGG + Intergenic
1182543099 22:31056001-31056023 CTGCATTCCCACCCACCTGCAGG + Intergenic
1183164059 22:36134197-36134219 CTGGAATCCCAGCCTGCTGCTGG - Intergenic
1183175673 22:36223208-36223230 CTGGCATCCCAGCCTGCTGCTGG - Intergenic
1184794808 22:46726039-46726061 GTGGCCTCCCATCCAGCAGGAGG + Intronic
1185026616 22:48417741-48417763 CTGGGCCCACCTCCAGCTGCCGG - Intergenic
950392521 3:12707801-12707823 CTGTACTCCCAGTGAGCTGCTGG - Intergenic
950427372 3:12931744-12931766 CTCGGGTCCCATCCACCTGCTGG - Intronic
951142198 3:19175956-19175978 CTAAACTCCCACACAGCTGCTGG - Intronic
952848750 3:37710820-37710842 CTGGCCTCGCAGCCAGCTGAGGG + Intronic
954146246 3:48635664-48635686 CTGCAGTCCCATCCAGCTCCGGG - Intergenic
954405313 3:50342134-50342156 CTGGACACCCTTGCAGCTTCGGG - Exonic
955383219 3:58458111-58458133 CTGGACTCAAAGACAGCTGCCGG + Intergenic
956311729 3:67888368-67888390 CTGGACACCCACCCAGCAGCGGG + Intergenic
960175844 3:114516812-114516834 CGTGACTCCCACCCAGCTTCTGG - Intronic
961426266 3:126850986-126851008 CTGGATCCCCAGGCAGCTGCAGG - Intronic
961781306 3:129322010-129322032 CTGGCCACCGAGCCAGCTGCAGG + Intergenic
962747882 3:138410974-138410996 CTGGGCTCCCATCCTGGTGATGG - Intergenic
963852661 3:150223949-150223971 CTGATCTGCCTTCCAGCTGCAGG - Intergenic
964808983 3:160642076-160642098 CTCTCCTCCCATCCAGCAGCAGG + Intergenic
968464115 4:741954-741976 CAGGCCTCCATTCCAGCTGCTGG + Intronic
968829592 4:2926087-2926109 CAGCACTCCCATCAAGCTGGAGG + Exonic
969449450 4:7264764-7264786 CCCCACTCCCTTCCAGCTGCAGG + Intronic
982781943 4:159500347-159500369 CCTGACTCCCACTCAGCTGCTGG + Intergenic
983317444 4:166149844-166149866 CTTGACTTCCATGCACCTGCAGG - Intergenic
984864503 4:184270198-184270220 CTCCAGTCCCATTCAGCTGCAGG - Intergenic
985680455 5:1253239-1253261 AGGGACCCCCATCCAGGTGCAGG + Exonic
990585537 5:57207703-57207725 CTGGCTTCCCATCCATCTGCTGG - Intronic
995724561 5:115169860-115169882 CGGGAATCCCGCCCAGCTGCCGG + Intronic
997222090 5:132177900-132177922 CTGTATTCCCGTCCAGCTGGAGG + Intergenic
997304716 5:132829053-132829075 CTGAACTCCCTTTCAGCAGCCGG - Intronic
998131983 5:139655926-139655948 ATTTACTCCCCTCCAGCTGCCGG + Intronic
999786849 5:154898470-154898492 CTGGGCTCCCACCCAGTTGTTGG + Exonic
1002618203 5:180468432-180468454 CTGCACTTCCATCCAGCTCCGGG + Intergenic
1012525649 6:100174485-100174507 CTGAACTCCCAGCCAGCTTTGGG + Intergenic
1013035838 6:106381820-106381842 CTGGACTTCCAACCACCTGGGGG - Intergenic
1014101630 6:117517668-117517690 CTTGACTTCCATGCACCTGCAGG + Intronic
1015182625 6:130377455-130377477 CAGGAGACCCATCTAGCTGCAGG + Intronic
1016936533 6:149452319-149452341 CTGGACACAAACCCAGCTGCGGG - Intronic
1017222688 6:151985126-151985148 CTGGAGTGCAATCCAGTTGCAGG - Intronic
1019572707 7:1720374-1720396 CAGGAGGCCCATACAGCTGCGGG + Intronic
1019998014 7:4737657-4737679 CTGGACCCTCAGCCAGATGCTGG + Intronic
1021086202 7:16423019-16423041 CAGGACTCCCAACCAGCAGGTGG + Intergenic
1021326320 7:19273568-19273590 CTTGACTTCTATCCACCTGCAGG + Intergenic
1021456327 7:20832872-20832894 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1029115114 7:98232695-98232717 CTGGTCTCCCGCCCAGATGCAGG - Intronic
1029276660 7:99409096-99409118 CTGGACTCTCAGCCAGCCACTGG + Intronic
1033214397 7:139483267-139483289 CTGGGCGCCCATGGAGCTGCAGG - Exonic
1033735158 7:144214880-144214902 CTTGACTTCCATGCACCTGCAGG - Intergenic
1033747898 7:144336089-144336111 CTTGACTTCCATGCACCTGCAGG + Intergenic
1035545576 8:479778-479800 CTGGACTCTCATCTACCTGATGG + Intergenic
1035788340 8:2280118-2280140 CTCCACTCCCACCCAGCTTCTGG + Intergenic
1035804467 8:2441587-2441609 CTCCACTCCCACCCAGCTTCTGG - Intergenic
1036239903 8:7072826-7072848 CTTGACTCCCATCATGCTGTCGG - Intergenic
1039062371 8:33581831-33581853 CTGGATTCCCACCCAGCAACTGG - Intergenic
1042359503 8:67866773-67866795 CTTCTCTGCCATCCAGCTGCTGG + Intergenic
1043150078 8:76704587-76704609 CTGGACTCCCTGGCATCTGCTGG + Exonic
1043155528 8:76774067-76774089 CTGGACCCCCATCCAAGTTCTGG + Intronic
1048742182 8:137573250-137573272 CTGGGCTAACATCCAGGTGCTGG - Intergenic
1048873068 8:138814668-138814690 CTGGGCTGCCCTCAAGCTGCTGG - Intronic
1049294699 8:141826010-141826032 CTGTACTCCCAGCTAGCTGGGGG + Intergenic
1049536976 8:143186986-143187008 CTGGACTCCCAGACAGATGACGG - Intergenic
1049709038 8:144055482-144055504 CTGGGCTCCCAGCAAGCCGCTGG + Intronic
1052851312 9:33380175-33380197 CTGCTCTCCCATTCAGCTCCAGG - Intergenic
1053351137 9:37414122-37414144 CTGGACTCAAATCCAGGTGAAGG - Intergenic
1056770528 9:89475122-89475144 CTGGTCTGTCCTCCAGCTGCAGG - Intronic
1056810088 9:89757392-89757414 CTGGTCACCAATCCAGCTTCAGG + Intergenic
1058539046 9:105992955-105992977 CTGTACTTCCATCCAGCTCAAGG + Intergenic
1058963364 9:110013129-110013151 CAGGACTCTCATCCACTTGCAGG + Intronic
1060550975 9:124485315-124485337 CTGGACGCCCCCGCAGCTGCAGG - Intronic
1060763530 9:126275894-126275916 CTGGGATCCCTTCCAACTGCTGG + Intergenic
1061140732 9:128764664-128764686 CCTGAGACCCATCCAGCTGCGGG + Intronic
1061422538 9:130480058-130480080 CTGGCCTCCCATCCAGCCAAGGG - Intronic
1062095970 9:134703591-134703613 GTGGCCTCCCATCCAGAGGCAGG - Intronic
1062445187 9:136590724-136590746 CTGGCCGCCCCTCCAGTTGCGGG - Intergenic
1062637323 9:137498448-137498470 CTGGGCTCCCCAACAGCTGCTGG - Intronic
1062736948 9:138142561-138142583 CTGGACTGTCATCCTGTTGCAGG + Intergenic
1187251068 X:17598258-17598280 CTGGACTCCCAACAGGCTCCGGG - Intronic
1190102098 X:47529650-47529672 CAGGCCTCTCCTCCAGCTGCTGG + Intergenic
1190950614 X:55139685-55139707 CTGGACTTCCATGCACCTGCAGG - Intronic
1191761806 X:64654791-64654813 CCCGACTGCCATCCACCTGCAGG + Intergenic
1195208210 X:102625206-102625228 CTGGACTCCCTTCCATATGGTGG + Intergenic
1195674350 X:107496450-107496472 AAGGCCTCCCATGCAGCTGCTGG - Intergenic
1197071877 X:122309111-122309133 CTGGCATCACATCCAGGTGCTGG + Intergenic
1197970272 X:132108240-132108262 ATTCACTCCCACCCAGCTGCTGG - Intronic
1199793470 X:151175759-151175781 CTCGTCTCCTTTCCAGCTGCCGG - Intergenic
1200399141 X:156008572-156008594 CTGGACTGTCATCCTGTTGCGGG + Intronic