ID: 946696038

View in Genome Browser
Species Human (GRCh38)
Location 2:222360220-222360242
Sequence CAGCTGTGCAAGAGAGCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946696038_946696045 13 Left 946696038 2:222360220-222360242 CCGTTTGCTCTCTTGCACAGCTG No data
Right 946696045 2:222360256-222360278 GGACTTGTGTCATCACCTCGAGG No data
946696038_946696041 -8 Left 946696038 2:222360220-222360242 CCGTTTGCTCTCTTGCACAGCTG No data
Right 946696041 2:222360235-222360257 CACAGCTGGGTCCCCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946696038 Original CRISPR CAGCTGTGCAAGAGAGCAAA CGG (reversed) Intergenic
No off target data available for this crispr