ID: 946696038 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:222360220-222360242 |
Sequence | CAGCTGTGCAAGAGAGCAAA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946696038_946696045 | 13 | Left | 946696038 | 2:222360220-222360242 | CCGTTTGCTCTCTTGCACAGCTG | No data | ||
Right | 946696045 | 2:222360256-222360278 | GGACTTGTGTCATCACCTCGAGG | No data | ||||
946696038_946696041 | -8 | Left | 946696038 | 2:222360220-222360242 | CCGTTTGCTCTCTTGCACAGCTG | No data | ||
Right | 946696041 | 2:222360235-222360257 | CACAGCTGGGTCCCCTTTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946696038 | Original CRISPR | CAGCTGTGCAAGAGAGCAAA CGG (reversed) | Intergenic | ||
No off target data available for this crispr |