ID: 946696066

View in Genome Browser
Species Human (GRCh38)
Location 2:222360415-222360437
Sequence GTTTAGTGGTTCTGCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946696066_946696068 9 Left 946696066 2:222360415-222360437 CCAGGTCAGCAGAACCACTAAAC No data
Right 946696068 2:222360447-222360469 GCCCCAAGAAAAGTAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946696066 Original CRISPR GTTTAGTGGTTCTGCTGACC TGG (reversed) Intergenic
No off target data available for this crispr