ID: 946696194

View in Genome Browser
Species Human (GRCh38)
Location 2:222362087-222362109
Sequence GATTTTCACTGTAAAGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946696194_946696200 -8 Left 946696194 2:222362087-222362109 CCAGAGACTTTACAGTGAAAATC No data
Right 946696200 2:222362102-222362124 TGAAAATCATTGTGGGGGCTGGG No data
946696194_946696199 -9 Left 946696194 2:222362087-222362109 CCAGAGACTTTACAGTGAAAATC No data
Right 946696199 2:222362101-222362123 GTGAAAATCATTGTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946696194 Original CRISPR GATTTTCACTGTAAAGTCTC TGG (reversed) Intergenic
No off target data available for this crispr