ID: 946698277

View in Genome Browser
Species Human (GRCh38)
Location 2:222383963-222383985
Sequence CATCAGAAGGACACTGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946698277_946698280 23 Left 946698277 2:222383963-222383985 CCTACCACAGTGTCCTTCTGATG No data
Right 946698280 2:222384009-222384031 TATTTGTGTTTGTTTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946698277 Original CRISPR CATCAGAAGGACACTGTGGT AGG (reversed) Intergenic
No off target data available for this crispr